Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4323  (registered. 2012)
Contig Information
Length 789 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|11467245|ref|NP_043077.1|| ribosomal protein S7 [Zea mays]
Score 302
Evalue 3.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4323
ATTCTTTTCCGATCGAGATGTACGGATCCATGTGTCTACATACATAGATTCTGTTCATGGATTAACGAAAATGTGCAAGAGCTCTATTTGCCTCTGCCAT
TCTATGAGTCGCTTCCTTTTTGCGTATGGCACCCCCACTCCCTTTGGCAGCATCTACTAATTCGGAACTTAATTTGAAAGCCATATTTCGACCCGGACGC
TTTTGGGATGCTTCTAATAACCAACGAATGGCAAGTGCTCTTCCTTGTTTAGATCCTATTTCAATCGGAACTTTCCGCGTCGATCCTTTTTTATTACGTC
TTGTTTTTACTCCTATATTGGGAGTTACTCTACGTATTGCTTGACGTAAAACCAATAGTGGATTTGTTTCTGTCTTTTGTTGAATCTTTTTCACGGCTCG
ATAGAGAATTTGATAAGCCAATGATTTTTTTCCGTCTTTCATAATACGGTTAACCACCATGTTAACTAATCGATTACGAAAAATTGGATCGGATTTTGCA
GTTCTTTTTTCTGCAGTACCTCGACGTGACATGAGCGTGAAAGAGGTTCAAGAATCCGTTTTCTTTTTATAAGGGCTAAAATCACTTATTTTTTTGGCTT
TTTGACCCCATATTGTAGGGTGGATCTCGAAAGATAGGAAAGATCTCCCTCCAAGCCGTACATACGACTTTCATCGAATACGGCTTTCCACAGAATTCTA
TAGGGATCTATGAGATCGAGTATGGAATTCTGTTTACTCACTTTAAATTGAGTATCCGTTTCCCTCCTTTTCCCGCTAGGATCGGAAAT
page-top