Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6041  (registered. 2002)
Contig Information
Length 681 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0764000 [Oryza sativa (japonica cultivar-group)] >gi|57012739|sp|O82451|GSTF2_ORYSJ RecName: Full=Probable glutathione S-transferase GSTF2; AltName: Full=GST-II >gi|3746581|gb|AAC64007.1| glutathione S-transferase II [Oryza sativa] >gi|15289890|dbj|BAB63585.1| putative glutathione transferase I [Oryza sativa Japonica Group] >gi|113533870|dbj|BAF06253.1| Os01g0764000 [Oryza sativa (japonica cultivar-group)] >gi|125527815|gb|EAY75929.1| hypothetical protein OsI_03848 [Oryza sativa Indica Group] >gi|125572126|gb|EAZ13641.1| hypothetical protein OsJ_003466 [Oryza sativa (japonica cultivar-group)] >gi|215708679|dbj|BAG93948.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765134|dbj|BAG86831.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765450|dbj|BAG87147.1| unnamed protein product [Oryza sativa Japonica Group]
Score 646
Evalue 8.91564e-66
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig6041
agCCAGGGTCCTTGTGAGCCTGGAAGAGTCCGGCGTCAAGTACGAGCTCGTCGCCGTCGACTTCGCCGCGGCCGAGCACAAGAGCCCCGCCCACCTTGCT
AGGAACCCATTCGGTCAGGTCCCAGTTTTGAAGGACGGTGACTTTTGCCTCTGGGAGTCACGCGCAATCACGAAATATATATGCCGAAAGTACAAACCTG
AGCTCCTTGGGGTTGGCAATCTCGAGGGATCAGCAATGGTCGATGTGTGGCTGGAGGTGGAGGCCCACCACTACCGTCCTCTCATAGAGGCTGTTCTTAT
GGAGATCAGGATCCGGCCGATTTTCGGGCAAAGGGTTGATGAGAGGGCCGTTGAGGAGAACATTGACAAGCTGAAGAAGGTGTTGGATGTGTATGAGTCC
AGATTGTCGAGCTCCAAGTACCTAGCTGGAGATTTCATCAGCCTCGCCGACCTCAACCACGTCTCCACCATGCTTTGCCTAGGGATCACTATATACACAT
CGGTGCTCGACATGTACCCGCATGTAAGGGCCTGGTGGGATGACCTGAAGGGCAGGCCAGCGGCGAGGAAGGTGTCGGATCTAATGCACATGtccgtgaa
gaatgatctaaaatgattatgttggcaactctttcattaatgtgtttgtacttttcggtattnggtncaaggtgtttgtgt
page-top