Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6036  (registered. 2002)
Contig Information
Length 552 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Bowman-Birk trypsin inhibitor-like protein [Triticum aestivum]
Score 400
Evalue 1.76782e-37
Total Hit Count 313
Registered year 2002
Contig Sequence     [ Download ]
>Contig6036
gaacccagtccctgttacatattcagtcTTTACAgccaatCCTCGCCAaccagaCGCAAGCATGAGGCCCCAGGTGCTGCTCGCTGCGTTGGCCGTCGTC
GCCCTCCTCGCAGCTGctctgCCTCTCGCCCACAGCCAAGGTGCGACCCCAAGTGCGTCGTTGTGCTGCAACAACTGTGGCACCTGCACCAGGTCTATCC
CGCCCAGGTGCACGTGCATGGACGCATCGCCCAGCGGCTGCAACCCGGCTTGCAAGACCTGCGACAAGACCACCGTCGCCGGCCGCGACAGCTTCCAGTG
CAAGGACCGTGTCGCAAACTTCTGCCAGCGCAGCTGCACTAAGGCCCCGTGACTCGGTCTGTTGTCGCCCGAATAATGCTGATTAgcttgCGATTTTTTT
TTTGCAGTATTTAAGAGTTCCCTCTGCATCTTTGATCTGGTAGATGCAGAGAAGAAATGAGAGTTTagtgcATGCTCGCTGTTCctt*ctTGTGTCTGAA
ATAAAGAGCatattctttgctcaaaatcttatttattaaaccaannaaaaaa
page-top