Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4289  (registered. 2012)
Contig Information
Length 753 bp
Clones alternative view 102 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 10
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 12
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 5
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|75282511|sp|Q43312.3|H2A7_WHEAT|H2A7_WHEAT RecName: Full=Protein H2A.7; AltName: Full=wcH2A-4; AltName:
Score 257
Evalue 1.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4289
TTTCAACCAAGAACAGAGTGGTAGAATTTTTTTTTTAAGCAATCCATAGGTGCAACTTTTATAGAACGAACTAGCAACGACTTACACAGGATGTAACCAT
TGTCCACACCTAGTTTAGCACCGGTACAAGCACACAGATTCAGAAACTAATAGTAGTACTAACATCCTAGAAGTAAAACGCAACACCTAGGCAACATTTA
ACTGAACACGCTACTACACAGAACTGGATACAGCCGAGCACCCACGACCACCGAGGAGTCGTCATCTAGCTATCGTCGTCGGCAGCCACGGCCTTGCTGC
CTCCGGCCTTCTTGGGGAGCAGAAGGTTGTGGATGTTGGGCATGACACCACCGCTGGCGATTGTGACCATGCCGAGCAGGCGGGAGAGCTCCTCGTCGTT
GCGGACGGCGAGCTGGATGTGGCGCGGCACGATGCGGGTCTTCTTGTTGTCCCTCGCCGCGTTCCCGGCCAACTCCAGAACCTCAGCGGCGAGATACTCG
AGCACGGCGGCGAGGTAGACGGGGGCGCCGGCACCGACCCTCTCGGCGTACTTGCCGGCCTTGAGGAACCGCGCGATCCTGCCGACGGGGAACTGGAGCC
CAGCCTTGGAGCTCCTGGAGATGGCCTTCTTGGCAGCGCCCGAGCCGATCGCCTTGCCCCTTCCGGCCATGTCTACAGTGCTTGGAGGGGATCCGCGGTT
GTGAAATGGAAAACGAGGCGCCGGGAGGAAGTGCGGAAGCGGTGTGGTGTGGG
page-top