Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4280  (registered. 2012)
Contig Information
Length 973 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464585|ref|NP_001055892.1|| Os05g0489600 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 3.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4280
GCTCACATAAGTATGTTCGCAACATGTACCATCCACATCACTCAACTGAACCAACCAACATTGGCAACCATAATCCAATCTTACTAAAACTCAAAAAGAT
AGGGGTTCAGACACACATTGTCGACACATTAAACCTTGTAAAACCACCGAACAGCAGCTGATAATATCCATACAAAAAAAGACAACCTGACCTGATACTA
GCTCACTTAAAGAAGGGAGCTTCTGCCTGTCACATACGCACACATACTATCTCTTGTGCAGTGTATATATATCACAATATGTAAAATGGTAGCAGTGAGT
TGTTGAGACATCCAGCACGTTTGTTTCTTGATGAAGCACTTGTCGAGACGCTTCAAGCCTTGTTGGCAATGTTGTTGGAGAGCCAGTCAAGTCCCTCGTA
CAACCCTTCGCCAGACGTTGCACAAGTGCTCTGAATGTACCAGTGCCGCTGGCGCAGGGAGTGCAGACCAAGCTTGTCGGTGATTTCAGCAGCATTCATG
GCATTAGGAAGATCTTGTTTGTTTGCAAATACAAGCAACACAGCATCACGCAGCTCATCCTCATTCAGCATCCTGTGGAGCTCATCCCTAGCCTCAACAA
CACGTTCCCTATCATTGCTGTCGACAACAAAAATGAGGCCCTGCGTATTCTGGAAGTAGTGCCTCCACAGGGGCCTGATCTTGTCTTGGCCCCCCACATC
CCAAACAGTGAAGCTGATGTTCTTGTATTCAACAGTTTCGACGTTAAATCCGATGGTTGGGATGGTGGTGACGATCTCTCCGAGCTTGAGCTTGTAGAGG
ATGGTGGTCTTACCAGCGGCATCGAGACCAACCATGAGAATCCTCATCTCCTTCTTGGCAAAGAGGCGGCTGAACAGCTTGGTGAACGTGAGCCCCATCT
CGAGGTGGAGACGAAGGCTTCGAGGTCTCGGCGCTCCGGTGCGGCGTGCTCCTCCTGATCTCGGGGGAGACGG
page-top