Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5591  (registered. 2002)
Contig Information
Length 369 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] (no hit)
Score 248
Evalue 6.55916e-20
Total Hit Count 0
Registered year 2002
Contig Sequence     [ Download ]
>Contig5591
gaagcctcatccttggaactccaagatgaagaaggtgGCACTGAAATGTAACAGTTGTGATGAGCATTTGCAAGATTAGGGTGGCGCATGCCTGAGATTA
AGAAGCTATTTTGCTGAGACAGTGAGATGGCCCCTAATTATTTTCTTCTTCTTCTTGAGATGATGGCTCCTAATTAGCAGCTAGCTACAGATATGCGCAA
AGGAGACAGGGAAAGAAAGGTACATGTTGATGAAGATGCTGCTGAAATTTGACAGTTGTGATGAGCATTTGCTACATATTAAGAATCTTTGTCGCTGTGA
CGGCATGTTTGTTgatggaCGGatggaTACCATTTCTATATAtcgtgtgtgacattcccaaaaaaaaaa
page-top