Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5589  (registered. 2002)
Contig Information
Length 584 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 361
Evalue 6.90398e-33
Total Hit Count 14
Registered year 2002
Contig Sequence     [ Download ]
>Contig5589
gcaggcccgcagccgtcccgcatcgcagtcgccgccgccgcgtcgtgccagctttgagcgagacgaaccgatggcgggcaccgcagccgtgtaccggagg
gtcatgaaggcagtgcagaagcacgtcggcgggagcgccgataagaagcacttccgcgagttcgtgGCCGCCGAGTTCCGCAGCCCGGCCGGCACGGAGG
CCGACGCCAGAGCGAGACTGCGGCTCGCCGGGGACTACGCGTACCATCTCACCAGCATCCAACACCAGAAGGAACTGCTATTCTCATACAATATAGCTGT
GGATCGATCTGATGAAATGAAGAAGATATTGAACAAATCTGCtgccagtgtaggccttcagcttccagatgtctaccagccttgagagcttgggcgaccc
gtggtactgcttttgggcaactttgcttgagttacaaatttccagttgttctggatagtttagcgtgctatagctgtaagcagctgtactctccccaata
acgaccagtggcattgattctcttgatgctttgtactaccttgttccatggcgtctgcttacccttaaattataaattcagctg
page-top