Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5585  (registered. 2002)
Contig Information
Length 906 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0385900 [Oryza sativa (japonica cultivar-group)] >gi|108708513|gb|ABF96308.1| ribosomal protein S11 containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548724|dbj|BAF12167.1| Os03g0385900 [Oryza sativa (japonica cultivar-group)] >gi|215706382|dbj|BAG93238.1| unnamed protein product [Oryza sativa Japonica Group]
Score 337
Evalue 1.03658e-29
Total Hit Count 201
Registered year 2002
Contig Sequence     [ Download ]
>Contig5585
atccggatcccccgcccccaaaacctccgccgagccccgagcgtagggaccccgccgccccgtaccactaccccgcgcccacgccacctctgcccgcttt
ccgtcaagatggtgacggcggtgagggcacttgggctcgccggacgagcgctgctgcgaccggttgcctcaacaggaacccaacggctgctgtcgactga
caagaactcactgcagggccttacgaacggcgatccggtgagccgcctcATGCAAACACGGAAGCAGAATGACAGCATTTACCGTCGCTTTGCTGAAAAT
GATTTCACAGGCGGCGGTAGCAGGTCTGGCCGATTAAACATGGAAATAACGTGGACAGCGGCTCTGCGAGTAAAGATAGATGTTCTACGCATCACACCCA
AGGAGAAAAAGACCTTTGTGACCGTTAAGGACGTCAAGGAGAACAGGAAGGCCCGGGCTTCTGCTGGCTGCTTGGAGGATCGAAAAGGGCGGTCTCGTCT
TGCTCGGTATGCCGGTGAAGCAACAGGGGAACACATGGGGCGAtccgccagcaagattggcctcaaatcaattgtcgtgaaagtgaaaggaagttccttt
ttcaggaagaagaagaaagtgctcttgagctttgcagccggttcccgtggtgcaagagtgaggagcccttctcctaaataaggttaacaatagacctgca
ggaacaagcaagaagagtgaaaatcaatatcctgcccgaaggagaagcaaaaaagatcgactggttccctaataacatcatgagcctacaagtatttatg
attattagccagtcttagatcgactcttgtaagacataaccattttgtcatttcctgtaatcctgctgaattgaggcttgttttatacgacatttttgca
gttccc
page-top