Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5486  (registered. 2002)
Contig Information
Length 467 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HGA6 [Hordeum vulgare subsp. vulgare]
Score 547
Evalue 1.12968e-54
Total Hit Count 251
Registered year 2002
Contig Sequence     [ Download ]
>Contig5486
cgccgacgtgctgctgggcgtgcacggcgccggactgaccaacatgatgttcctggcgccgggagcgacgatggtgcaggtggtgccgtggggcgggctg
cagtggatcgcccgcatggactacggcgacccggcggaggccatggggctccggtacgtgcagtacgagatcggcgtggaggagagctcgctcaaggaca
agtacccgaggggacacaagatcttcaccgACCCGACGTCGCTGCACAAGAAGGGCTTCGGgttcatGCGCCGGACGCTCATGGACGGCCAGAACATCAC
CCTCGACCTCGGCCGGTTCCGCGGCGTGCTCCAGCAGGCGCTCGGCAACTACCTcgtgcAGTAGTCCGACATAGCTAGAATGAATGAATATACcgtatAT
GCATCATGTATATGTATACACACATACTTCCATTATTTTTCATTTTTCAGTCTGCcagattaaatgt
page-top