Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4261  (registered. 2012)
Contig Information
Length 639 bp
Clones alternative view 81 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 6
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 6
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 3
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 2
WH_XA Root 6
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 15
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439177|ref|NP_001043868.1|| Os01g0679700 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 1.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4261
TTTTTTTTTTAAAAAAAGAGATAAAAACCTTATCATATAAGATTGACTTGGGGTGCAGAGGGGTAGAGAGTGAGAGACGTGTCACAAAAATACAAATAGG
TTGGCATAACGCATAACAGGCAGCTGTAGGGACATACTTTCAAGTTTCAAAGATCCTAAAATCAGAACCAAAATTACTAACAGATATCCATCGCTCGATA
GCCAAAATACAGAGATTGTTAAGTCTTCACTCCACTACAGAACCCCTGGATTCCTCAAGACAACAGTAGGGCAATCATGCTTCGGTCTGCTCCCTCAAGC
GACGGATCGTGCTCCTGACGGTGACTGCACTAGCAGTGTTCATGGTATAGGCGCCGCCAGCCTTGACCTTGCCACAGTCCTTGCATCCCCAAATTCCAAC
AGCTTTCCTCTTCACAGCAAACTTCCCACAGAATTCACAGAAGTACTTGGAGTGCTGAGACACCTCCATCTTCTTGATCTGCTTACGCAAACTGGCACCA
TACCTGGTACCATACTTCCCGACGATTCCGGCCTTCTTGGTGCGCTTCGTCATCTCGGCGGCGGGTAGCAGGAGGCGGCTGCGGCGGCGTAGGCGGGGAG
ATGGCGGCCTCGTGCCGAATTCGGCACGAGGCCTCGTGC
page-top