Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4250  (registered. 2012)
Contig Information
Length 768 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
WH_SP 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115445715|ref|NP_001046637.1|| Os02g0305700 [Oryza sativa (japonica cultivar-group)]
Score 323
Evalue 1.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4250
TAGAGCCAATCAACCGATTCCCCCTCCCCACTCCACCCCGCGCCGCAGCGAGAGCGAACTGGTCCCTGCCTTCCACTGCCGGCCGCGTCGTCGTCGTCCC
CTCCCTCCCTCCCTCTCGCTGCGCTCCCGTCCAAGACTGGGAACATGTCAGATAGTGCATTGCAAGATCTCAATGCTGCTCAATCTGTTGTGCTGGAGAA
AAGCAAAGACAGTTCTGTGGAACCCTGCAGTTCTAAGCCCGTGTTAAACGGGAACAAATGTGTCAAGAAGGAAGGAAATGCTGTACCTGCATGTCCTGAT
GTAACCAATGGATGCGATGCTGTAGTCGTAGATGTTGAATATATTGATTCTGAGGATCTCACGGATCTTCCAGATGTTGACACAAGCCTGAGTACTTTGC
TTACAAGGTTGGATTCAAAGGATTGGATCAAGACATGTGAAGCTCTTAATAATGTTCGTCAGTTGGCAATATATCACAAGCAAAGGTTGCAGGAGCTGCT
GGAGCCTCTAGTTCCTCTTATTGTGAAATCTGTTAAGAATCCAAGGAGTGCTCTATGCAAAACTGCACTTATGACCTGCGCTGACATCTTTAAGGCATAC
GGTGAACAAATGGTCGACTTGATTGATCTGCTGCTAATGCCGCTATTTCTGAAATCTTCACAAGACAAGCGCTTTGTTTGTGAAGCAGCTGAGGCAGCCC
TTATGTCAATGACAAGCTGGATCTCCCCCTCTGTATTGTTACCAAAAATGCAGCCCTACCTCAAGAAC
page-top