Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4244  (registered. 2012)
Contig Information
Length 1622 bp
Clones alternative view 318 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 3
Wh_h Spike at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 13
Wh_DPA20 Seed DPA20 7
Wh_EM Dormant seed with water absorption 14
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 12
Wh_KMP Shoot grown under continuous light 7
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 12
Wh_OKCS Seed DPA5 12
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 7
Wh_SHDr Shoot grown with dessication 9
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 5
Wh_VSCB Liquid cultured tissue 18
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 9
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 7
WH_CA 2
WH_SP 7
WH_XA Root 26
WH_XB Root 34
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 13
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|399414|sp|Q03033.1|EF1A_WHEAT|EF1A_WHEAT RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha
Score 899
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4244
CCGCCGCCGCCTCCTCTCGGCTCCTTCTTCCTTCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCCG
GCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAAGCCGCTGAGATGAACAAGCG
GTCGTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGAGGGGTATCACCATTGATATTGCCCTGTGGAAGTTCGAGACCACCAAGTAC
TACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGACTGTGCTGTGCTCATCATTGACTCCA
CCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTG
CAACAAGATGGATGCCACCACTCCTAAGTACTCGAAGGCTCGTTATGAGGAAATTGTCAAGGAAGTCTCTTCGTACCTGAAGAAGGTTGGCTACAACCCT
GACAAGGTTCCCTTCGTCCCCATCTCTGGGTTTGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCTACCCTTCTTGAGG
CTCTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTGCGTCTTCCCCTTCAGGATGTTTACAAGATTGGTGGCATTGGAACTGTGCCTGT
TGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCTTTGGTCCCACTGGTCTGACAACTGAGGTCAAGTCTGTTGAGATGCACCACGAG
TCTCTGCTGGAGGCGCTTCCTGGTGACAACGTCGGCTTCAATGTCAAGAACGTTGCTGTTAAGGATCTGAAGCGTGGGTTTGTTGCATCCAACTCCAAGG
ATGACCCTGCCAAGGAGGCGGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATCGGTAACGGCTATGCCCCAGTGCTGGACTGCCA
CACCTCCCACATTGCTGTCAAGTTTGCTGAGCTGGTGACCAAGATCGACAGGCGATCTGGTAAGGAGCTGGAGGCGCTGCCCAAGTTCCTCAAGAATGGT
GACGCCGGTATCGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTCGCCACCTACCCTCCTCTTGGCCGCTTTGCTGTGCGTGATATGAGAC
AAACGGTTGCTGTTGGTGTCATCAAGGGCGTGGAGAAGAAGGACCCCACCGGTGCCAAGGTTACCAAGGCTGCCATCAAGAAGAAATGAGTGCTCTGGTG
TCTGCCATCGAGTTATCTAGCAGAAGTTTTAGTGTCAAGTCTTTTTTGGAGAATCTTAGTGTATGTTAAGTGTTATTCCTGGGCGTTGTTGCACTTTGAC
TCCTGCACCTGTGTGCGAGCTATGATGTGTCGTTTAAATACTCTATTTCGATTCCATTATTGTGCTCTCATCCCATTTGTGGTTTTGTCTGCCTGTGTTG
AATGCTAGTACAAGATAGTTAT
page-top