Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4215  (registered. 2012)
Contig Information
Length 1456 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XA Root 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|223635282|sp|A6XMY9.1|METK1_TRIMO|METK1_TRIMO RecName: Full=S-adenosylmethionine synthase 1; Short=AdoMet
Score 785
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4215
AAAATAACTGGATAGAGGAAACCGCACAAGTACTGCGGTTTCAGTAGACTCAAAAAGCAAAAACAAAGCACAGAAGACATCAAAAGACCCGACTAGTATT
AACTCAGCACATATTTCTGTATGCCATACCAAAATACCAATCACTAGACGCCAATTCAGCGTGTCCACGGCGATGTTGAAACCCTGCTTCCTTCTAAAGA
GAAGGAATTCAATTATCCAAGATACAACCACCAGCGGCAGCAGCAGTAATGATAGACTCCTTCATACCCACGTCTCAAGCAGAGGCCTTGTCAAACTTGA
GGGGCTTCACAACCTCCCAGGTGAAGTCAGCATCCTCACGGCCAAAGTGGCCATAAGCAGCCGTCTTGATGAATCTGTTGCCACCCTTCTTCAAGTCAAG
GTTGATGCTGATCATCCCAGGCCTGAAGTCAAAGTTCTCCTTCACAATCTTGAGGATCTCCTTATCGGGGATCTTGCCAGTACCATAAGAGTCAACGAAG
ACAGATAAGGGCTCAGGCACACCAATGGCGTAGGAGATCTGAACAATGCAGCGGCGTGCAAGACCGCTAGCAATGATGCTCTTGGCAGCCTGCCTGGCAA
TGTAGGCGCCACTGCGGTCAACCTTAGTTGGGTCCTTGCCGGAGAAAGCACCACCTCCGTGTGCTCCCCAGCCACCATAGGTGTCGATGATGATCTTGCG
ACCAGTAAGACCAGCATCACCATGAGGGCCACCAATGACAAAGCGGCCTGATGGATTCAAGTGGAATATGGTCTTCTCGTCCAGGTACTTCTCAGGGATC
ACCGGCTTGATGACATGCTACTTGANNTCCGCAGCAATCTCATCATTGGTGACAGTCTCATCATGCTGGGTGGAGATCAGAACAGTGTGCACACGTACAG
GAACCATGGCNNNNCCCTCGTTGAGGTATTCAACCGTGACCTGGGTTTTGCCATCAGGNNNTAGCCAGGCACAAGTGCCATTCTTGCGGACTTCAGTGAG
GCGGGCACCCAGCTTGGTGGCAAGCACATGGCTGAGGGGCATGAGCTCAGGGGTCTCATCGGTGGCATAGCCAAACATGATACCCTGGTCACCAGCACCA
ATATCCTCAGGGCGCTTGGTGAAATGTCCGTGCACACCCTGGGCAATGTCAGGAGACTGCTGCTCTATGTTGACAAGCACCTTGCACCGGTCCGCATCAA
GGCCAACATCATCAGAGATGAAGCCAATGTTGCGGCAGGTGTCACGCACAATCTTCTCATAGTCAACCGTGGCCTTGGTGGTGATCTCACCAAAAACCAT
GACCATGTTGGTCTTGGTGCATGTCTCACAGGCAACCTTGCTGTCAGCGTCTTGGGCGAGGCACGCGTCAAGCACAGCGTCAGAGACCTGGTCGCAGAGC
TTGTCAGGGTGGCCCTCGTTCACAGACTCAGAGGTGAAGAGGAAAGTCTCGGCCGC
page-top