Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4947  (registered. 2002)
Contig Information
Length 704 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09931 [Oryza sativa Indica Group]
Score 614
Evalue 4.88989e-62
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig4947
caGCGTTGTCGTGGCTCGTCTACAACCTAGCCACACATCCACACGCCATGCTTGCCATCCGCGAGGAGTTGGCGCCGATCGTCGCCACACGCAAATCAGG
CGACGGTGTTGTGGTGTTTGATCCAGACGAGACCAAAGATCTAGTGTACCAGCGAGCGGCCATGTTCGAGTCGCTGAGGCTGTACCCGATCGCGCCCATG
GAGCGCAAGGAGGTCGTCGCCGATGACCTTCTGCCTAGCGGCCACAAGGTGCAGGCCGGCAGCACCATCCTGATCTCGACCTACAGCATGGCGAGATTGG
AGCAGGTGTGGGGAGATGACTGCCGGGAGTACAGGCCGGAGAGGTGGCTGTCGTCCAACCAAGACGGGAGCGGCCACACGCTGCGGCACGTGCCGTCTCA
CGTGTTCGTAGCGTTCAACACCGGACCGAGGGCATGCCTCGGCAAGAACATCTCCGTGGCGCTGGTGACATCCATCgttgccacggtggtgtggaacttt
gatgtggagctactggatagtaacaccgtgaagcccaagctgtcggttattctgcagatgaagaacgggctcatggccaaagttaagaggagaccagagg
acgactgaggggacaccgatccaaattaattgtcactgtttttgtacaacttgtactaaaacaccaacaattattnaatcagagagtaacaaataaacaa
ataa
page-top