Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4933  (registered. 2002)
Contig Information
Length 476 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit K1 glycoprotein [Human herpesvirus 8]
Score 75
Evalue 6.00774
Total Hit Count 1
Registered year 2002
Contig Sequence     [ Download ]
>Contig4933
gaaatgcatgaggggagTTCAGTTGTGCATAGCATGTGAATTAGCCTATGTACTGTATCATATCTTTGCCGAGATTGGGTGGGGGACGTGGACGCCTGTA
CAGGAAAACATAGCGCGTAGCATGAAGAGGAGAACATCACTAGTGTACAGTTCGGTTCTCGGTCAGGATTTTAGGGCTGTAGCTTTGTTTTGTTTTCCAA
CCATCGCTTGTACTTCCTCTGTAAAGTAATATAAGAGCGTTTAGATCACTAAAGTAGTGATCTAAACGGCCTTATATTACTTTACGGAGGGAGTAACTTG
TAAGAACCACTCTAGTCATCTTCATTCTTTATTTGTTCGTTCAAACTTATTTCCATGTGGTGCTGTCATGTTGAATGAGTTCTTGTACCTGCTTGATTGA
ACTGTTTCCTGTGAAACTCTTGCAGGCCAGACATGCAGgccccatttaattaatccaaatacctataaaaaaaaaa
page-top