Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4185  (registered. 2012)
Contig Information
Length 1021 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 3
Wh_SH - 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226496830|ref|NP_001143379.1|| hypothetical protein LOC100276013 [Zea mays]
Score 230
Evalue 2.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4185
GCACGAGGGCCCAGGGACGCGCAGGACTAGGAGGGTGTCAGCGTAGGCCAGAGCCAGAGAAGAGCTTGCAGGTGAGAACATGGCCGCAACGGCGTGCTCT
ACGGCGCTTCTGGGTGTAGCAGGAGCACGCCTCCCCGCCGGCGCGCCGCCAACCTTTCTTCTCCCACGGCGTCACTTCTCCCCTCGTCGCCTCCAAGATG
CGCCGCGGCTCTCTCTGCTCCGGGCGAAGGCCTCCTCCGGTGACACCTCTGCCGCGAGCGGCGACGAGCTCGTCGACGACCTGAAAGCCAAGTGGGACGC
GGTCGAGAACAAGTCCACCGTGCTGACGTACGCCGGCGGCGCCATCGTCGCCGTATGGTTCTCCTCGGTCATCGTCGGCGCCATCAACTCTCTGCCTCTG
CTTCCCAAGATCATGGAGCTTGTTGGGCTCGGCTACAGCGGATGGTTCGTGTACCGCTACCTCCTCTTCAAGGAACGCAGGAAAGAGCTGGCCGACGACG
TGGAGTCCTTGAAGAAGAGCATTGCTGGTACAGAGGCAGAGTAAAAGAATATAATGTTGTAGTATGGGTTATTATTTTGTTTGACGATTATTCAGAGAAC
CCTTATCAGAGGGTTTGCTTGTTTTTTTAACAAGGCAAGAGACTTGTCATTTTCATTGATTAAGAAAGAACATTTAGACAAAAAAAAAAAAGTAGGAAAA
CAGAGCAATTACTCTTGTGGCATTACAGTACTCAAGTGTGCAGGCCCAGCCAGGCACATAGCCTAAAAAAAAGGTATCCTGGCCACGGTGGCGGCGGCGG
TGGAGGCAGCGGCTGCCGGTACCAGTGCTGCGGGCACGGGCGTGGTGGCTGCCGCTGCTGCGCAAGCCCCAACGAGATCCCGGAGCCCATGTATCGGGCG
GAGGTCCGCAACTAAGTGCCAGATGCTACCTACGGATGTTGCTACTTGCCTGCACGTAGTAACTACTCGTATATGTGGTCAATAAGAAGGAAGGTGCATG
TATGTAAGTACGCGTGTACAG
page-top