Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4182  (registered. 2012)
Contig Information
Length 754 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|167073|gb|AAA62698.1|| ubiquitin [Hordeum vulgare subsp. vulgare]
Score 318
Evalue 4.00E-85
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4182
TTTTTTTTTTAAGCTCAAGAACACATGTATCAAAAGATACATGCTCCATGATCACATCACCATCAGATCAACAAAGCATAAAATACGATAGCTGCCATGA
GATAGATTAACGTCATTCAAAATGACCAAAATTTAAGCTCGCATAGCATCTCAGCATTAGGCAATCAAATATCTAGGAAACATAATACTCCAAGGTTTCA
GTTTTCAAATACAAACAGGGACACATATAAATGAGTTCTATCCTCGATAGGTAAAAGAGCAGAGCAAACGCAAGCCACCTCTAAGCCTTCTGGTTGTAGA
CATAGGTGAGGCCGCACTTGCCGCAGTAGTGGCGGTCAAAGTGGTTGGCCATGAAGGTCCCGGCGCCGCAATCGGCGTTGGGGCACTCCTTCCTGAGCCT
GGTTACCTTGCCGGTGGCGTCGTCGACCTTGTAGAACTGGAGGACGGCGAGCTTCACCTTCTTGTGCTTGTGCTTTTGCTTCTTGGGCTTGGTGTACGTC
TTCTTCTTGCGCTTCTTGGCGCCACCGCGGAGGCGGAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCGGCGAGGGTGCGGCCGTCCTCGA
GCTGCTTGCCGGCGAAGATGAGACGCTGCTGGTCCGGCGGGATCCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCCGAGGACTCCAC
CTCCAGCGTGATGGTCTTGCCCGTCAGGGTCTTCACGAAGATCTGCATCTTGGC
page-top