Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4663  (registered. 2002)
Contig Information
Length 638 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10891 [Oryza sativa Indica Group]
Score 514
Evalue 1.56768e-50
Total Hit Count 50
Registered year 2002
Contig Sequence     [ Download ]
>Contig4663
tgaGATGAGCCTTgcagcAGCatcacATAGtcacaTTTACATGTACAGCTAGctataGCTTATGCCTAAAGCCAGTTCCATAAGATTCTTGCCATGTGTG
AGAATCGCACAAGGACCATTATATGTTGGCCCAGCAGCACTGCTCAAATTACAAGAGAAAAATGAAAAGAAACACATCGTTTTTATCGCGACAAGCTTGT
TGGCTAGGCTCGCCCTACGGGAGATAGAGGTGGCTGACGCGGCACATAGCTGGCCGGAGCTCTACCTTGGCcggctgctgccatagccttcagcttatga
tcggcaaagactgcatcgtcttgcgaggttggcaaatcggcctgcgtcctcacagggctcctcccatgaagcatcactatacacatagcgaaggcctgaa
gtaaagcaatggatgatctgaattcgactgcatataacccttctttaaacgaaaccatactgaaggcatgacgatcctcccgtgatcgaccctgagagag
caagtcgaatcgatggctgccatcctgcgtttggttcacctgaatagacttgcatccttggtttccttgggtgttgtcggtgaggacactcagcgtgcaa
ccttcatcccacccaccacagtcacatgatcctctgga
page-top