Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4652  (registered. 2002)
Contig Information
Length 656 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05001 [Oryza sativa Indica Group]
Score 467
Evalue 4.6623e-45
Total Hit Count 56
Registered year 2002
Contig Sequence     [ Download ]
>Contig4652
acaatctttgacaacggaagccaaagcaaaccaatccatttcagggttcaccactccaaactatatacagacacaattaagattctactcaactggagac
cccacacaccaacaatctgcttaaaaaccactgatacatgatgcaagaattaacaaccaggtcatAGCCCTAATAACAACATCAGCGACCTCGAGTCTCA
ACCGGACACCAAACTACGAACAAGCTGGCACTAACATACACCCCTTAGTCCTCCACTATAGCTGCTTACATGGCCACATTGGCCAGTCACCATCACCTGC
CCGCTTCGACTCCCCAGCTCGTCCGTGGTGGGTTCATCACCGAGGAGCCTTGCTCATCCAAGCCTCCAACCACGAGGGCGTCACGGCTTAGATCTGGTGA
TGCGTTGCGGAACCTGCCATCCTTGTCCTCCAGCAAGTTGCCCAGACCTCCCAGGTCGCCTATCTCAGCTGCCATCCTGGGCTCATCCCATGCCACCGGC
TTTCTGCCCATCTCGATGTCGCCGACAGCTCTCCCCATGTTTGGGCTCATGAAACCGTTCGTCGAGCGAGGCCTCAGGCCCTGCTCCTGTGGAACTCTGG
CGCCGAAGTTGTTCCTGGAAGCAGGGATCGGCGTGAagaagatctccttgatgttc
page-top