Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4172  (registered. 2012)
Contig Information
Length 1202 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_PCDAM Anther at meiosis 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461885|ref|NP_001054542.1|| Os05g0129100 [Oryza sativa (japonica cultivar-group)]
Score 608
Evalue 3.00E-172
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4172
TTTTTTTTTTATACCGACAACAACACAGGCATTGTTTCCTTCCAAACTTTGAAAAGAACTTCAACATCACAATAGTCCAACATGACATTTTATTCCCTTC
CAAATTTCGAAAGAAACTTCAACATGTAGATCTTAAGAGATCTTGTTTACACTAAGAGGTAGAGGCTTCAAGAGCAGGTAGACATTCCCTTATCACCTCT
GCAGCTTGCTCCAGCTCCTTCTCCGACACGATGAGCGCAGGCACAAGCCTCACCACATTGCCTTTCCCGGCCGTCAGCAGAAAGACACCAGCATCCAAGC
ACGCATCGACCAAAGGCCCAGCCGGTACGTCGAGCTCAATGCCAACGATGAGACCGGCCCCCCGGATCTCTTTGACATGAGGGTTTCCACCCAGCTTAGT
TTTGAGCAGCTGCTTGAAGTATTCTCCTTTCTTGGTCACCTCTGCTAGAAAGCCAGGTTTCTGGATCTTGTCCAATGTGGCTAATGCAGCATGGCACACA
AAAGGGCCTCCGCCGAATGTGGTACCATGGTCACCGTAGTGTATGGCTGCCGCAACCTTTTCGGTGACCAAGGCCACACCAATGGGAAGGCCGTTGGCCA
GTGGCTTCGCCAAGGTCATTATGTCAGGTAATACACCATAAACCTCATGGGCCCAGAGGTAACCTGTGCGCCCCAGACCACATTGCACCTCGTCAAAGAC
CAAGAGAGCCCCTGCCTCATCACAAGCATCCCGCAGTCCCTGCAAGAACTCCTTGGTGGCACTGTGAATCCCACCCTCACCCTGCACGGGCTCGACAAAC
ACAGCAGCAATCTTCCCCGACTGTATCACCTTCTTGGCCTCCTCCAAATTGCCATACTCTGCAAATGTTGAGCCGGGCATGACCGGTTCAAAGGGCTCCC
TGTACTGCACCTTGCTGGTCAGCGCGAGCGAGCCAATGGTCCGGCCATGGAAGCAGTTGGTGAAGGACATGAACTCCGTAGGCGCGTCACCGTTGGGGTG
CGCGACCCTCTGGTACTTCCTGGAGAACTTGATGGCCGCCTCGTTGGCCTCAGTGCCGGAGTTGGCGAAGAAGGCACGGTCAGCGAAGGAGGCCTCCACG
AGCCGCTTGGCGAGCTCCACCTGCGGCACGGTGTAGCCGACGTTGCTGGCGTGGACCAGGCGTCCGCGNNGGTCCGCGGCGGCGGCATCCACGTCGGGGT
CG
page-top