Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4167  (registered. 2012)
Contig Information
Length 909 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_SP 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222636388|gb|EEE66520.1|| hypothetical protein OsJ_22995 [Oryza sativa Japonica Group]
Score 467
Evalue 7.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4167
ATACAGTACTGATCAATCTAGGTTTACCACTTTTTAGATAAAAACATGAAACAGGGATTAACCTCGACCCTTCTTCACCTATAATATACGTGATCACATC
ACTATGCATGCCTTGTCTGAATAGATGTTAGGACTTAGGAGACCTTGAATGGCTTGTACCCTGCGACGTCCTTGATGAGCCCCTGCACAGAACCAGCTGC
GGCGAGGACAGAGACGACAAGGCACGCGACGCTAAGCACGTTCATCCACGTCCACGTCGGCGAGAACCGGCGCACCTTGGCCTGTGCCATGTACATCTCA
ACGGGGAAGTAGACGGTGAGCGGCCAAAACGAGACGGCGCCAATGAGGCCAAGGAAGTCGTTGAAGAAGGGGAACAGCATGGCCACCACCGCCGTGAGAA
CCACGTACGCCGTTCGCCAGACCAGGCGGAACGGGCTAACCGGGACCTCGCCGCCTCCGAGAACGGCCGGAAGGCGCAACACGCGCTCGGCATGGAGGAA
GGCGCTGTCGGGCCACCGGGAGCGCGCCCAGCCCTCGACGAACTGGTAGATGGGCTGGCAGAAGACCTGGTAGGCGCCAACGAGGTGCACGACGATGCAA
ACGTTGCCGATGTCGACGAGCCAGAAGGGCTCGTAGAAGCCGAAGCCCGTGAGGAAGTTGCCCGGGGCGCTGCTGCCGAACGCCGCGTAGCCCAGCACCC
CACACAGCATGTAGAACGTGGTGGTCGTGGAAACGCCGATCAAGGACGCCTTCTTCATCACCGTGTTCTCCGCCGGGCTCGACCGCAGCGTGTCCTGGAT
TTCGATGAGCACATTGGAGTAGGAGTATGCAAAGGCGATGTCCCCAAGAGACTGGAACGTCCTCCAAATTTTCTCACGCCCGGATACATCCACCCCAACG
GTCACCCCT
page-top