Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4497  (registered. 2002)
Contig Information
Length 876 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25842 [Oryza sativa Indica Group]
Score 841
Evalue 3.52218e-88
Total Hit Count 344
Registered year 2002
Contig Sequence     [ Download ]
>Contig4497
aatgtaatagatgaggctattcgtctgaattctactggtgaggaatcacatttggcgatggaaacaagtggccatggagcactgaaagagaatcactggc
tcgatgatggagcatatatgatggttaaacttctgaataaacttgctggtgccagaacattgaacccaaacatcggtagtaaagttttgactgatttggt
cgagggccttgaggaggctgctgtgacagtggagataaggttgaagattgatcaaaatcatgcagatttgaaaggagggtcctTCCGTGACTATGGAGAA
TCAATCTTGAAACATTTGGAGAGTGTGATCAGCAAAGACCCAAATCTAAACAAAGCCCCGAAGAATCATGAAGGCGTCAGAGTTTCTGGATATGGTGGCT
GGTTTCTGTTGAGGCTATCCCTCCATGATCCGGTTCTTCCCCTTAATATTGAGGCACAAAGCAAGAATGACGCCATGAAGCTCGGACTTGCAGTGCTTGC
TGCTGCGAGTGAATTTTCAGCATTGGACACAACTGCATTGAACAAGTTTTTGCAGCAGTGAAGGGTAGGAAAATCGATTGATCTGCAGCCTTTGCATGGC
GTCTTGTTCGTCTGTGTTGAGCTGGATTTGGATACAGGGCAACAATACtatacaaagaaatacttgtttcaaactgtgccctacccatatatatacttca
cggcctctccttggtaaggaagtaccaaaacgaattcttcatgttctccagcagatgacaaagcaattgtcaaaaatcttgcatactgacatggccgcat
ggatgctttgtccttgaatatttgcaacttaatagttaggccctaaatctcacaaatctgcaaggcagaaacatgt
page-top