Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4492  (registered. 2002)
Contig Information
Length 638 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003084 [Oryza sativa (japonica cultivar-group)]
Score 296
Evalue 2.97715e-25
Total Hit Count 150
Registered year 2002
Contig Sequence     [ Download ]
>Contig4492
gggaGACCTCATCCTCTGCCGCCTGTCGAAGAACAGGAGGGTGACGCTGCAGGAGTTTAAGGGCAAAACGCTGGTGTCTATCCGCGAGTACTACTTCAAG
GACGGCAAGGAACTGCCCACCTCCAAAGGGATGAGTATGACGGTCGAGCAGTGGGAGACATTCAGCAAATCAGTACCCGCAATAGAAGACGCCGTCAAAA
CACTTGGAGAATCAGATTGAAAGGATGCCACAAAAACCTTAAAATCTCGACGCTCGTTCTGGACCTCTGCAAGTAGAGTAGTCCATGGGTGCTCTGAGTA
CTCCATGGGGCTACTAGAGTTCATCTGGACTTGTATAACGGGCCCTTAAGGCTATGGTGGACCGAAGTACCGGACCTACTGATGTGTGCTGGGTAGACAG
TTCATCTGGACGCTCGTTCTGGACCTCTGCAAGTAGAGTTCTCCCTTAGTCAAGGTACCGGACCtacctGATGTGTGCTGGGTAGACAGTTTGGGTGTGT
TCGCGAACTAGTTCTCCGCCGGTATGGTGgacccgAAGTTTCATCGCTGTGCCATGTGATCTCGTGCTGTTTAATTGTCCTTTCTGATATCGTAAGATAT
AACGGgcccttaaggctatcgttgtgagaaaaaaaaaa
page-top