Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4489  (registered. 2002)
Contig Information
Length 482 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016189 [Oryza sativa (japonica cultivar-group)]
Score 113
Evalue 0.000233598
Total Hit Count 27
Registered year 2002
Contig Sequence     [ Download ]
>Contig4489
gtGCTCATGCTGAAACGCTGGAGAAAGGATGGTCTTCTGTGGGTTCAGCGAAGAAGAGGCTGTCCTTTCCGGCTGGGACGCCGCCGCCGGTGCCGTCGGC
GGCGGCGAGACGGCACTCTGGGCCTCCCAAGGTGCGGCAGGCGGCCGTGGAAGGTGGTACCGAGGGACGGGACTCGGCGCTCGTGTGACATCATGGAAAG
GAGATTATTTGTCTGAAACAGAGCAGAGCAGAGCGGGATTCGTTGTGTTTGTTGAGTCAAAGGAACGTAGAATGTGTGTTGTGTTGTGTGGATCCATTTG
ATTTGATTTGTATTCCTATTTGATTTGTTTATTCATTCACTGAATAAGCGTCTATCTGTAATGATTTGATTTGCAGGGAGAGGTTTTTCGGATCATCATC
ATGTGTATGTATGTATGTGTGTGTTGACAAGAAGatgaggagttttttgaatTTCAAAtcatgatgatgatgaaaaaaaaaa
page-top