Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4484  (registered. 2002)
Contig Information
Length 679 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_035519 [Oryza sativa (japonica cultivar-group)]
Score 622
Evalue 5.35259e-63
Total Hit Count 50
Registered year 2002
Contig Sequence     [ Download ]
>Contig4484
ataaacATTGTtgg*aaaag*agGAGGTTGAAAGAAGCCTTTATGGGCAGCTTGTTCTTGGTGAAGGAGTGGCCTCCAGTTTGGATGAACAACTTACCAA
GGAAGTACAAAAGGCTGCTTCTGCAGAGAAACAGAGGATAGCAGAAGAGGTTGCATCACTTCTAAAACTCAGCGTTGACATCAACACGGCATCTAAAAGT
TCCGAGAAGATAATAGCCACGCTGCGAGCTGGGGCCGAGTATGCGGGATGCGGCGTGCAAAACTGCATCCTTGTAGCGGGCAGCCAACCCAGCGTCATCG
CAGCCGAGCGCATTGGCATGCCGTGCATAGTTGTCCGAAGCAGCCTAACCGCGAGAGCAGAGTTTCACTCCGCGAGGGCCGTCATGGATGGGTTCGGTGA
CACGGACCTGACAGTATCGAAACTACCGAGTAAGAGGTGGGCTTAATACCGTTGCGAACTAGGCATTGGATGTGAGTTCCCTGCTATCAGTCTGTAACCG
ACCGACTGCGTGATGATTTGAACCGTCGCTTGATGTAAACCTGAGCTAGCAAAACGAGGCGTTATGTAATGCTGAGCTTGCGGCAGAAAGTTACAATAAG
CACCAGCCTGCTTTGTTGTGTTTTtgttgttattgtaccggtgaagtattgaacatttgtactattattcgatcgagtt
page-top