Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4162  (registered. 2012)
Contig Information
Length 2921 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_SH - 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XA Root 3
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|39726035|gb|AAR29967.1|| putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 808
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4162
TTTTTTTTTTGTTTTTTTTTTGATGCAACAGCTGCCTTATATAAATAGTCGGTGTCACAGTGTGTATAAATACAATTCGGACATAATATACTCTAAGCAA
CAAAGAACAGATATCACAAATGGGGGAAAGGGGAGAAAAAAAATCACAATGTACGCTGCTGCAGGTTTCGTAGACAGTGGTTCTCAGCAGCATGGGCGGC
TAACCAAAGGGGCAACAATTAATTTAGATAAACTCCTCCCGTCTTCATCTACAACCAAAAAAATCCCATCTAACCCCCTCCGGTATTTACACGAGGGGGG
CAGATACTCTTGAGCGCCGATGATCCGATCAGCAGTTGACGCCGCACTGCCCCATGGCGACGGCCTTCTGGGTGTCGGATATGAACGGGTCGATCTTCAC
CCACAGGAGGGAGAAGATGGAGGCGAGGAGGATGGACCAGACGATGACGATGGTCGGCGTGCGGTTCTGCTTTCCCATGAGACCCTTGAGGAAGGGGTAG
AGATGGAGGATCACCCAGATCGAGAAGAAGAGCTTTCCGAAGAGCGGGCCCCAGGATTGGTAGCCGCTGTTGATGGCGTATGATATGCCGGCCACCATGC
CCACAAGGTTGATGACCAGGACGGTGGTCGGAGGGATCAGGAGACTGGTCCACTTGAACACGTATAGCTCGGCGAAGTCGCCGTCCTCGTCGTTCGCCTT
GGATGTGACAGTGAAGTTGGTGTCGATCCCGGCCAGCACCTTGAGCAGACCCTGGAACACCGCGAAAAGATGGGCAGATGTGCCACCGATAACCCAGAAC
TGCTCGTTTCTCCACCAGTCCTCGATGCCGACACCACTCCATCGGAGCTCCAATATACCAGTGGCAAAGATGGAGGCAAACATGAGAATGAAGAACATCC
CAGCATAATTACTGATCTCGGGGATGATAAATTTGTTGGTGAGGAGGCAGATAGCAGGAAGCACACAATAGGCGATAAGTGGGAGGGATGTTAATGGATA
AACAATGGTGTTGATGTAAGCCACCCTCTCCAGAAGTTTCAACCGCCCACCGTAATTGTACCAGATAGGACAATGTCTGCTAAACAGAATTTCAACTGAC
CCAAGGGCCCATCGGAGCACTTGATTAAGACGGTCAGACAGATTGATTGGCGCAGAACCCTTGAAACAAGGCCGTGGTGGCATGCAGTAGATTGATATCC
ACCCTCTTGCGTGCATTTTAAACCCAGTAAGAATATCTTCAGTAACTGAACCATAGATCCAGCCAATCTCTTTTCCCCATTCGGTCTTGTCCTCGTATCC
ACAGCTGATGACATGGATGGCTTCCTTTAGTAGAGAAGCTGGGTTTGTTGAAGGTGGTATGCCTCCTTGAGTCATAAAGGTGGATGCAGTAAATATAGGA
GACTGACCAAATCGTTTCTCCAATCTCTTCTGGGACATAAGCATTGACCTTTCATCCTCATAACCTTCTATACCCTCTTCTGCTCCCATCTTCAACATGG
ATGATATAGAAGAGGGTATAGAAGGTTATGAGGATGAAAGGTCCATGCTTATGTCCCAGAAGAGATTGGAGAAACGATTTGGTCAGTCTCCTATATTTAC
TGCATCCACCTTTATGACTCAAGGAGGCATACCACCTTCAACGAATCCAGCTTCCCTACTAAAGGAAGCCATCCATGTCATCAGCTGTGGATATGAGGAC
AAAACCGAATGGGGAAAAGAGATTGGCTGGATCTATGGTTCAGTTACTGAAGATATTCTTACTGGGTTTAAAATGCACGCAAGAGGATGGATATCAATCT
ACTGCATGCCACCACGGCCTTGTTTCAAGGGTTCTGCACCAATCAATCTCTCTGACCGACTTAATCAAGTTCTCCGATGGGCTCTTGGGTCAGTTGAAAT
TCTGTTTAGCAGACATTGTCCTATCTGGTACAACTACGGTGGGCGGTTGAAACTTCTGGAGAGGGTGGCTTACATCAACACCATTGTTTATCCAATAACA
TCCCTCCCACTTATTGCCTATTGTGTGCTTCCTGCTATCTGTCTCCTCACCAACAAATTTATCATTCCTGAGATCAGTAATTATGCTGGGACGTTCTTTA
TTCTTATGTTTGCCTCCATCTTTGCCACGGGTATATTGGAGCTCCGATGGAGTGGTGTCGGCATCGAGGACTGGTGGAGAAACGAGCAGTTCTGGGTTAT
TGGTGGCACATCTGCCCATCTTTTTGCAGTGTTCCAGGGTCTGCTGAAGGTGTTGGCCGGGATCGACACCAACTTCACGGTTACCTCGAAGGCAAACGAC
GAGGACGGCGACTTTGCCGAGCTATATGTGTTCAAGTGGACCAGTCTCCTCATCCCTCCGACCACCGTCCTTGTGATTAACCTGGTGGGTATGGTGGCAG
GCATATCATATGCCATCAACAGCGGTTACCAGTCTTGGGGTCCACTCTTCGGAAAGCTCTTCTTCTCAATCTGGGTGATCCTCCATCTCTACCCCTTCCT
CAAGGGTCTCATGGGGAAGCAGAACCGCACGCCAACCATCGTCATCGTTTGGTCCATCCTCCTCGCCTCCATCTTCTCCCTCCTGTGGGTGAAGATCGAC
CCTTTCATATCAGATACCCAGAAAGCCGTCGCCATGGGGCAGTGCGGCGTCAACTGCTGATCGGCGCCGGAGAGTATCTGCCCCCCTCGTGTAAATACCG
GAGGGGGTTAGATGGGATTTTTGTTGTTGTTGTTGTAGATGAAGGCGGAGTTTTATTAAATTATTGCCCCTTTGTTAGGAGTATTTAGTACCCTTGCCTA
CGAAACCTGCAGCGTACATTGCAATCTTCTCTCTGTCTCTCTTTTTCCATTTGTGATGGTACTACCTGTTGTTTGTTGCTTATAGAGTATAAATATTATG
TCAGAACGTATTTATACACAC
page-top