Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4160  (registered. 2012)
Contig Information
Length 933 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218200694|gb|EEC83121.1|| hypothetical protein OsI_28280 [Oryza sativa Indica Group]
Score 275
Evalue 4.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4160
CACTAGTAGAAGGGAACATCATTCACAACACGATGCAGGTACCACTAAAACTCGACAGCATTTATGATAGACGGGTAAACCAAAAGGAGATGAGAAGGCC
ACTAAAACTGAACAGCATTCACAACACAACACAAGTAAAAAATAAAGAGAAGAAAACAAGAAAGAACACGGAAGCAAGGATCCACGAACAAGAATTTTGG
AACTATGATATTGAAACTATAATAACCTAAGTGGAGGCGAAATAAGGACTATGATGTTCACAACTGAAGCAGCAGCAGCCCACGCCTGAACTCGAATCGG
CATCTTTTTCCCTTCTCAACTCCAGACGAGCATCAAATCATAGCTGCTCCAAACTAGTAAATGGCAGAAGATAAATCAACTGCTCTCCTCCACAGGACCT
TTAGTTTTGTTTGCGTTGCTTTCTTCGGCCTTGATGGTAGCTGTCTGTGCATCATTCATTGAGATGGCACCATCACGTTTGTTATCACTTTTCTCAATTT
CTTTCAGCTGGACACTCCGAGAAAATGAGTCCGCGATATGAGTAACAGAATTCCCTACAGCCTTAGCGTCTGTTGGCTTCAGGGACTCTGCGCTGCCAGG
CTGCTGCTGACGTCTATTTTCCTTCAAGGCTTTCTCCCGTTGCTCATAGAAGTAGAAGTCCTCCACAATGCTTGTCTCGGCCTCATGATTCTTGAATATG
CTTAGCATCTGGAGACCATACTCTAGCTTGACCTCCTGGGTGTCCCTGCTATTTGTTACAGGTTTGTTGTCATTATTCTCAAGTGTGATGTGCCGGAGTA
GGGTGTTTGGGACATCCTTAATAATGTGCCACTTCACAGGAAACTGGCCACTCCACTTGTCTTGCTGCCAATAATCAACACTTCTGTCAAAGTCAACAGG
TCCAATCATCTCAGCAACACCACAGAACTGACC
page-top