Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4155  (registered. 2012)
Contig Information
Length 802 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_PCDAM Anther at meiosis 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_SP 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig4155
GAGCACGATGGACCTTCGCCTCGCCGCCGCCTCCCGCAAAATTGGCCGCCCCGACTACGTCCTCCTCTGCACATATGGGTGCAGCGACGCGGTGGACATT
AACAAGACCACAGCGTGCGTCTCGCTGAGCAAAATGGGATGCATCAAGGTAACCATCTCAAAACAAGATCTGCCATCGATCTCCTACTTCCATGTTACCT
GTCCCGACCTCACAGAGAACCCCTTCACCCAAAGTCCTGAGATCCTTTGGTCGTCGGAGAACTTCATCCTCTTCCGTGTCCATCTCGTGGGACCCGGCCC
ACCAGAGTTCTTCCTCTATATGGTCGAAGGCCCGGAGTTCAAGAGGCCGATGCTTAGTCTGCTTCCTGACTTTGGCTCGTATTGTGTTCGCGAGATGCTA
GATCCATACCTTGTAGGCGTCGTTCCCGACGATGACGGCAAGAGCCATTTCGTGACCGCTTTCAAAAGGAAGGAGTCAGCGGATTGCGAACTCCACATCT
ACAGGCTTGAAGGCAGTACCGGGACCTGGAGCAAAGAGCATATTTTCCCAGATTTCCCCTCCTGGGCACGTTCAGGGGTTTTTCCAGATAAGGTGGTTGC
ATTAGGTCAAGAAGTGGGCTATGTCGATCTCTTGAAGGGGATTCTTTTCTGCAATGTGGTCAAAAATCCGGTGAAGGCACATTTCATTCCATTGCCGAAC
CTGCTACCCAACAACCAACACTACTTCTATGAAGAATTGCCAGGACAGGCAATACGTGATGTCACCTGCACTGATAGTTATAAAATCATGTGTGTTGAGC
TG
page-top