Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4154  (registered. 2012)
Contig Information
Length 879 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226897529|gb|ACO90194.1|| superoxide dismutase [Triticum aestivum]
Score 309
Evalue 3.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4154
CACGAGGATTCATCATCCCATCCCCCAAGTCATAAACCCAAGTCGGACTCGCCTTCCTCCTCCCCCAACTACTCCTCCTCGCCTCCGCGCATCGCACCGC
ACCGGGGGTCACCTGAGATCACATACACAATGGTGAAGGCTGTGGCTGTGCTTACCGGCAGTGAGGGTGTCAAGGGCACCATCTTCTTCACCCAGGAGGG
AGATGGCCCGACCACCGTGACGGGAAGTGTCACTGGACTCAAGGAAGGGCTCCACGGCTTCCATGTGCACGCTCTTGGTGACACCACCAATGGCTGCATG
TCAACTGGACCACACTTCAACCCCGCTGGTCATGTGCATGGGGCACCCGAAGATGAAATCCGCCATGCTGGTGATCTTGGAAATGTGACAGCTGGAGCGG
ATGGTGTTGCTAACATCAATGTTACTGACTGCCATATCCCCCTTACTGGACCAAATTCAATTGTTGGCCGTGCTGTTGTCGTCCATGGTGACGCTGATGA
TCTTGGCAAGGGTGGACATGAGCTGAGCAAGAGCACTGGAAACGCTGGTGCCCGTGTTGCTTGCGGAATCATCGGGCTCCAGGGCTAGATGTCATCTTCG
CCGACCAACGTCGTACAGATCTGGGAACCTTTTCAGAATGCAGATTTGCAATCTCTATTCTAAATAAGCACATGATCTTTGATCACTTGTTAGTGTGCAC
CATTCATGTCAATTCCAATGTGCTACTCTGAACTTTATCACTGTCATTTGGCTATGATTTGCGTGACTGGAACAGTTGTCAAGTGCTTGTGGATCTGCTG
TTGTTCTTTAAGCCGCTACCAGCTCTGGACATATTTACAGAAAAAAAGAGAGATTTCAGATTTCATCTTATATCTTGTA
page-top