Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4153  (registered. 2012)
Contig Information
Length 604 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_VSCB Liquid cultured tissue 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242083870|ref|XP_002442360.1|| hypothetical protein SORBIDRAFT_08g018820 [Sorghum bicolor]
Score 178
Evalue 3.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4153
TTTTTTTTTTATTTTTTTTTTCAAAGGAAGGATATATTTCGATCTATTAAGTAGCACAATGTGGCCCTTAACAGGAGGAAGGATTCGATACAGTAGTTCA
AGTAATTTTATTTATAACATGATAAGCAGCAGTGGGTTCATCAAGCACTGAAAACTTTCAAGGATTACAAACTGATCCTGATCAGATGGGGAATGTTAGA
AACTTGAAGGGGCTGGAACACATCATTAGATTAGTCAGGTGTGGCAACGCCTTGGTTAAGCTCAGCAAATCGCATGCCAACCCTCATGGAGTGCTTCAGG
AACTTCTCGGCGCAGCGGCGGACACACGACTCCTCTTGCTTGTCCAGCGTCTTCCTCCGGAATGTGTCAACACAGTCCTTGAAGCACGTCTCCACCAGCG
CATTGTACATCCGTAGACTGTCACGCATCTGCAGCTGTTCGATCATGGCGGACATGCGCATCTTGTCCTCATCGGGGAGGTTGTCGAGGTCGCCGAGCAT
GCTCTTGTCCATGGTTGCCGCCGCCGCACGAAGGGGGAAACTCTAGGGTTCTCGGAGAGGGGAGAGGGGAGACGGCGAGATCTAAACGGCACGAGGCCTC
GTGC
page-top