Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4151  (registered. 2012)
Contig Information
Length 832 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_SH - 1
Wh_DPA20 Seed DPA20 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 3
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199961|gb|EEC82388.1|| hypothetical protein OsI_26733 [Oryza sativa Indica Group]
Score 298
Evalue 4.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4151
GAACACAGGACCCTTATAGTATCATGGAATCCACAATAATAATGGCCAGGCGTGCTTTCTGGCATACAATTTGCACCATTCCAAATCAATCAATTATTGA
CACCAAGCACATACATAAGCAAGGGTCCCAAATGTCACGGATGATAGGTAGTGGTAAGCAGATATGCTACACCCAGCAATCACTGCACTTGACTCCGGCT
TAGGTGAATGTCTCACTCGATAGCATTCCTCCTTTAATACTTCGTCTTTCTTTAGCTTAAATTTGACAGATACTGGATCCCTCCGTTTATCTTGGACCTC
AATCCGAGGAAGTTACCTGGGGCCGACGTCCTTGACTGCGCAGATCTGCTCCTCCCCCATGGCCGACATGACCGTCAGCGCCAGATCCTTCCCCTCAGCA
AATCCGTCCTTGAGCTGGGTCAGGATAGCATCATCAGTTGGGAGTTTAAGATCATCCTTAGTGCTACCATTATCAGTAAGAAGGCTCACAAATCCATCCT
CTGATATGTCAATCAGCTGATACTCAGTACGGTCCACATGTGGCACATCACAGTTGTGGGATGAAGGAACAATGTCCTCAAGCTTTTTACCATTGAATAT
ATCTAAGGCAACAAAGTGGCATTTAGCATGACCGTGCTTTCCTGTCTTCGAGGTAGAAACCTCCACCACCTTGCAGGGGCGGTTCTTGATGACGAGGAAG
CCGCCCTTCCGGATGGCGCCGGCCTGCATAGGGTAGGTCTTGGACGCCCCGGCATCGGCCTTGGACTCGAAGTGGTGGTCCTCGGAGTCCGACATGGCGA
CCTTAATCACCTGCTGGGCTGGATGATGGATC
page-top