Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4150  (registered. 2012)
Contig Information
Length 765 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218190031|gb|EEC72458.1|| hypothetical protein OsI_05805 [Oryza sativa Indica Group]
Score 316
Evalue 1.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4150
GGACCAATCACATGCTCGTATTTAATTTGCCTAGTGACAAACTGGATTTGATCAGAAGCATCCTTTACAGATTCAACAGCGGCACTTGCTCTGCAAGTTT
GCACCGGATTGTTGACATTATTGTATACCACTACTACACTATTATGTTTAATCTACTTGTGGGACGAAGTGCCATGTTGTTCGATATGAACAACTTCTAT
CGATGTTCTTGTCTTGACAAATGTTGGAAGTCAGGCGGTTGTTACGCCGATCGCCATCGGATCTTCAGGTATCCGAATTTGCCAGCACCGGGAGACGAAC
CCTCAAAGACAATTGGTAGGTAACCGGTGGCTGCTTTGTATCTTTTCTGGATCTCGAAAATCTCTTCACTACTTTTCAGGCTATTTTTCCCAATAACACA
AACTGAACCACCAGAACCTCCACCAGTGATCTTTGCACCAAATAGACTCGGGCCTTCATGTTGCGAGGTGGTCTTCCTGTGCTGGATTTCTTGTACTAGA
TTCACCAGCCTGTCAGTCCCATCAGAACCAAGCCCACAAGCATTGTAGCTGTAATGGCACTGATACATAAGTTCTCCAAGGGCTGAAAGTTGCTCATCTG
TTTTGGCTGCTGTTAACAATGCTTTGAAGGCCTCAACACGGAAGTTCTCATATATGGGATGTCTAGTAGGAGCCTTCACACTGTAAGATCTTTTTGGGTC
AATAACTGTTNNNGCATCGTTGTGATCTCCATATTTCTCCATAAATTCATCCCCAGTAATGAACT
page-top