Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig415  (registered. 2012)
Contig Information
Length 1075 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_CA 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242052629|ref|XP_002455460.1|| hypothetical protein SORBIDRAFT_03g011180 [Sorghum bicolor]
Score 450
Evalue 2.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig415
GGCAGCGAGCCCCTTTCGCCCGCTTCCCACTCCACGCCTCCTTCCCCCCTCCCAGATCTCCCCACCACACGGCCGCGCGCACCGGAGAAACGTAGCGAGA
CGGCTGCGAGTGGTAAAACAGCAAAAGGGGAGAGGCCACCGCAGCTCGCGTACCGGCGGTGGGTGGGTGGCGGCGTCCGTCACGCGTCGGCGTATCAGGT
GATGGACGCTGGCGGCGGGGGCTTAGGCGGGTTCCAGTGGACCGCGGAGGAGGCTTCGACGATCGGGGGCATCGCGACGGTGTCGCTGCTGCACTCCTTC
ATCCCCACGCACTGGCTCCCCTTCTCCATCGTCGGGCGCGCCCAGCGCTGGCCGCTCTCCCGCACCCTCCTCGTCACTGCATTTGGAGCAGTCCTTCATG
TTGTATCAACCGCTCTTCTCGGGATAACTGCAGTTACTATGGCAAATACTATAGCAGGCGAGGAAACAGTGCATAAACTTGCCTCGCTGTTGCTAATATT
TCTTGGAGCAGGTTACATTCTGTTGTTTGCGTTAGGAAAAGGTGGTCATAGCCATGCCCATAATCATCCAATGGAGAAGATGGCAGTCGCTGGTCTTGTA
CTTGTACCAGCATTATCACCCTGTGCAACTACTCTTCCAGTGTTTCTTGCTGTTGGCAACTCATCCTCGATGATGATTCTTGCGATCATTGTACTTCTCT
TCAGTACCATCACGGTGATGACGTCCCTGGTGGCTCTCTCATTTTATGGTGCTAGCCAGATCAAGTTTCACTGGGTGGAACGCTATGACAAGGTCCTAGT
TGGCTCAGTACTGTGCCTTGTTGGGGTTCTGACATATGTGTTCCATCACCACGATGGTGACGAGCATTCTCTCCATGCACACGTGCACAGGAAACTTGTG
GGTCCTTAGAGGAATCTACATAGTTACTCCCAAAGTTCACTGTGAAACAGATTCTGTTGTCCTCTAACCTTTGTACGTTATGCTGTATAAGATCTGATTA
TCAATTTATCTGTTGGGAATCTACCCGCCTATGGGTTTCCTAGGAATACAGACAGACCAGGTGAATGCCATGGAT
page-top