Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4149  (registered. 2012)
Contig Information
Length 751 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig4149
TCATCCCAGTTCCTCCCCCCACCAAGAACCTAGGGTTAGGGTTAGGGAGGCGGCGGCTGCTTTATTCCCGATCCCGCCCGATCGCCATGGTCATCGCAGG
CGAGCCAGAGCCGGAGGAGGTGGCCGTCATGTTCTCCGATAGGTTGAGGGCGGAGGAGGAGACCGTCGTCTTCCCCGGCTGGGTGATGCTGGATCGCATC
GGCCGCACCCACTGCGACGGCGACCTAGGAGCTGCTCGTGAGGCTGTCAACGGGAACAAGACCGCCGTTCAAGTCGAGATGGACAGCGGCCACTCCTTCT
ACGTGTCCTTCACCCTCGCGCCTCCTCCACAAGGGGCCTCTTACCTTGATCTCCACTGGCCGCTGGAAGGCTCAGCCAAATCCGTGCCCCCCTACAAGCA
GCCTGCCTATCCCTTCGTCCGGGCAATCGACAAGGACCTCGTCCTCTTCCACATCTCCATCCCGAGCCTGCCTCACCGCAACTTCGTCCCGCCAGATCTG
TTCGTCTACAATGCCGCTGGTCACCCCCCCTCGGTGCAGCAGCTCCCTCTGTACAGGAGAAGGTCATTCCTCAGGGTTAACTTCACCACAGGCATCCTGC
GGCGCCAAAACGGCAGCTACATCGTTTCCGACCTCAATGTCTACCCAAAAAAGGAGGGCACTGGTAATAATTCCATGTGCGCCGAACTCTGCGTCTTCAA
CTCCAATACACGGGCGTGGAGCTTCTTCAGCAAGGATGCTCCGCAGCCCCA
page-top