Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4148  (registered. 2012)
Contig Information
Length 1071 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125537802|gb|EAY84197.1|| hypothetical protein OsI_05578 [Oryza sativa Indica Group]
Score 481
Evalue 8.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4148
TGAAGCAGCATATGCAAAGTCATTCCAAAGAGAGATCCTTCGCCTGCCCACTTGAAGACTGCCCCTTCAGCTATATAAGAAAAGATCACTTGAACCGGCA
TATGCTTACACATGAGGGCAAGTTGTTTACATGCCCTCTAGGAGGTTGTGGCAAGAGGTTCAGCATCAAGGCAAATATTCAAAGACATGTTAAGGAAATG
CATGAGGATGAACATGAATGCAAAATCGATGACACTAAAAGCAACCAACAGGTTATTTGCCAGGAGGAGGGTTGTAAAAAGGCTTTCAAGTATCCTTCAC
AGCTGAAGAAACACGAGGAGTCACATGCCAAATTGGACTATGTGGAAGTAGTCTGCTGTGAGCCTGGCTGCTTGAAGACATTCACAAATGCCAAGTGCCT
GAGGGCTCATAACCAGTCTTGCCATCTATATACTCACTGTGATATTTGTGGGGAGAAACACCTGAGGAAGAACATTAAAAGGCATCTACGAGCTCACGAC
GAAGTGCACTCTACTGAAAGGTTGAAATGCAGTTTTGATGGCTGTGAATGCTCCTTCTCCACCAAATCAAATCTAAACAAGCATATGAAGGCGTGCCACG
ACCAAGTCAGACCTTTTGAGTGTCGGGTCGCGGGGTGTGGCAAGACATTCCCCTACAAGCATGTCAGGGACAATCATGAGAAGTCGAGTTGTCATGTATA
CATAGAGGGCGACTATGAGGAGATGGACGAGCAGCTGCGCTCGCGCCGAGGAGGTGGGCGGAAGAGGTCGGCTGTGACGGTCGAGACGCTGACTCGCAAG
AGGGTCACCATCCCCAGCGAGGTCTCATCGCTTGATGATGGGGCGGAGTACATGCGCTGGATGCTCTCCGACCGGGATGGTTCGAACCACGCTGAGTAGG
CGTGTGCTGTGTATGTTGTTGCAGTACGTTTTTGAGGTTGTCAAATGTATAGGGGGTCTCTACGGTGTTTGGTGCTCAAGTCGGTGTAGTTGCGTGGAAA
TCGTGTTTGTGTGTATTTATGCAGAGTTCTGATTTAGTAAGTATATATAGTACTAGTAAGTAAAAAAAAAA
page-top