Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4147  (registered. 2012)
Contig Information
Length 1081 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XB Root 3
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig4147
TTTTTTTTTTGAAAATAGCCATCAGTAATAACAACAAGACAATCAGAGTCTATTGCTCCATACATGCCGACGAGAATGAATCTCATACACGGTTACTAGA
AGAAAATGGCACAATCATGGATGGTATTAATTAAGTGGAGACAAGAAAGTGGCAACTAAAACACACAACAATCAGGAGGATCGGGTCCTGTCTTGTCCTC
GAAAGCACAGCACACACAAGAGAAAAGAGCAGCCTGGACCGGATCGGACCACATACAAGGAAGGAAATGGACAAGACATGCATCAGATCATACACACCCG
CACCGCACTCATGGCTTCACTCCTTGCTGAAGCACCCGTTCGCCATGACCTGCCCGAGGACGCAGGGAGCAAACATCATCGTGTTGAGAGGGCAGGCCTT
CCCGATCTGCACCAGGCAAGCGATGCATGCTGCAGGGCACAGCTTGGAGTGGATGATGTCCTCCATCAGTGCGAGAACCTCAAGGCTCAGCTCGTCGGAT
GGTAGGACGTCGTCATTGCCGGCCTCGGCTAGCATCACCAGCTGGCTGGTGAGCAGAAGAGCCAGGAGGAGCATCACCACCACCTTCCGGTCAGCCATCT
TCTTACAGCTAGAGCGCGAGTTTGTGTGGCCTGGCTGAGTGGGTGTTTACTTGTGTGTTCTGCTAGCTGTGTGTTTGGGCGGGCGTGGGCGTGCTATTTA
TAGACAGAATCTGAGGCTCCACGATGCACATATATGTGCTCTTCTTCTTCATTCTTACTTTCTTCTTTGACTGTGTGTGTGCAGTGACCAACCTTGAATG
AGTTTTAATTACTTGCTGGTCTAAAGAGAGAGCTCTTTGAAGTTGGAAGCAGGCCAGGCACATGACATGCCCGCCCGCCCGCCCGCCCGCTAGGAAGGAT
CACTATCTTACTTACTTTTTTGGGGGAAGAGGAGCTTTGATCTCGTCTTGTTGTTGCGAGAGGAGGGAGACCTAAGCTAGGATGCGCCGGCCGTATGACA
CAAGGGGAGGGCCGAGAGAGAGAGAGAGATTTGCAAGTGCAGTGGTCACGGCTTGGGTACAAAACTGAGAGAGAGAGAGCC
page-top