Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4130  (registered. 2012)
Contig Information
Length 697 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 6
Wh_oh Pistil at heading date 5
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
WH_XA Root 6
WH_XC Root, treated at 50 microM Al for 6h 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222641863|gb|EEE69995.1|| hypothetical protein OsJ_29904 [Oryza sativa Japonica Group]
Score 256
Evalue 2.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4130
TTTTTTTTTTCAGGGAAAACGCGGCGCAGAAAATCTTTGCATAGCTGATAATTAAAGGCGATCCGCACTTCACATCAAAGTCGACATGCTTATAGTACGA
TAACATGACCAGCATCGATAGCAAGATGTTCAACAGCGTCGGATCCTCGAGGCGAACAGAGAAGAAAACTCCAGATTCGGCATTAAGTCTACTACAGGGA
GCAAAACGATCCAAAAGCGCCACTGTTCGAAACATTTCACTCGTCCTCCTGGCTGCGGAGCCTGGCGAGCTTGTTGGTGACCACGACGTCGAGCTGGGCG
GCACGCTCCACTATCGCCTTGCGCTTCTGCGTGGACACGTTGTGCGCGATCTCAGCACAGTACGTCCTGTTGTGCATCATAAGCAGCTCCAGCTCAGAGA
CGTTGTGCACCACAAACTTCTTGAACTTGTTTGGCAGGTAGTGCCTGGTCTTCTTGTTAGAACCATATCCAATGTTGGGCATCAAGGTGCATCCCTTGAA
CTTCCGCCTGACGCGGGAGTCTATACCCTTTGGCCTGCGCCAGCTTTGCTTGAGGCCGATGTAGCGGTCGCTGTGCGCCCTCTTGAAGTGCTTCACCCTC
TTCTTCACGATCGCCGTCTTCAGGATAGGCACCGCCATCTTGCGAGGCGAGCGGCGGCGGCGGCGGAGATGGGAGGGAGTGTGAGGGGGGAGAGGAG
page-top