Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4112  (registered. 2012)
Contig Information
Length 932 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115446947|ref|NP_001047253.1|| Os02g0582400 [Oryza sativa (japonica cultivar-group)]
Score 362
Evalue 4.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4112
CTCGAGTCCAGGAAGCCTTCTTCACTCCTCCCCGTCCCATCGATTATCTGTGGCGGCCATGAGGGTAGCCTCCATGGTGGTCGTCCTCGTCCGAGACTCC
GCGGGCTACGGCGCAGCCCTCGCTGACGCGCTCCGGCCGTCGCCGGGGCTCACGAGGGGTTCCTCGCCCTTCGATCTCCCTCTCGATAAGTACGGCCTCA
ACGGCGAGAAGGCCTCTGGCGAGCTCGTTAGCTTCTCTGACTCCAGTGGCTCTCCTCAGGTGTCCTTTTTTGTTCTGCCTGACTATAGGCCTCCTGTTGC
TGCATGTGCTATGAATGAGATTTTAGCATTGATTTCTTCTGAAGCTCCCTCCATCCAGCCCGTTCTGATTGTACCATTCATCACAAGACCATCAGGCTGT
TTCCATGGAATGGTTAATGCAACCAAAACTGGGCAGTTAACTACACTTCACGCTGCTGAAATAGGGGCATCAAATGAGTTTACTCACTTGTTGGTTGATG
GAAGTATTAAACCTCCCCCATCTTTGCAAATACGTAGTGAACCAATACAATGTTTGCTGGAAATAGTGCGGGTATTGAAGATACCCACAGTTCTTGTCAC
ATCAGGTGGGCAGCACCAAGGCAAAAGTTCTTCAGACTCTGACCTTGAGGTGCTGCAGTGCGTGGGAGATCACGTAGCCAAGCACATCAACTTGGAGTTC
TCCAAAGAAACTGTCATTGAGACAGGGGTTGAGAAATCAGCGAGCATTCAAGAACCCTGGCGTGAACTGTATCTGTGACGATTCTAAAACATATCGTCTT
TGTGCCCTTATAAATAGATATCTTAACATTTTAGATTCGGATGTACTTTTTTTTTCTTTTTTTTGCGGGTGGAACCTATTCTGTTCATGGTGTGGTAGTG
ATGAATTATGTGATTTGTGCAAGGGGCTTGTA
page-top