Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig407  (registered. 2012)
Contig Information
Length 1041 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 3
Wh_oh Pistil at heading date 2
Wh_EM Dormant seed with water absorption 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471716|gb|AAW50989.1|| ribosomal protein L7 [Triticum aestivum]
Score 481
Evalue 6.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig407
TACCCTCGCCGTCTCCTCTCCCACGAAGCGCAGCCCGTCGAGATGGCCTCCGAGGCGGCGAAGGTGGCGGTGCCCGAGAAGGTGATCCTAAAGAGGAGGA
GGGAAGAGGTCTGGGCCGCCGAGAAGAAGCAGAAGGTTGCCGCCGAGAAGATAAAGGCCGCCGAGAACACCAAGGTCATCTACGCCCGCGCGGAGCAGTA
CGCCGGGGAGTATGAGGCCCAGGACAAGGAGCTGGTGCAACTTAAGCGTGAGGCCCGGATGAAGGGTGGGTTCTATGTCAGTCCTGAGGCAAAGCTGCTG
TTTGTCGTCCGTATCCGTGGTATCAATGCAATGCACCCAAAGACCAAGAAGATCTTGCAGCTTTTGCGTTTGAGGCAGATTTTTAATGGTGTGTTCCTTA
AGGTCAACAAGGCCACCATTAACATGCTGCGTCGGGTTGAGCCATATGTTGCCTACGGGTACCCTAACCTCAAGAGTGTCAGGGAGCTGATCTACAAGAG
AGGTTACGGAAAGCTCAACAAGCAAAGGATCCCTCTGGCCAACAACAAAGTCATCGAGGAGGGTTTGGGGAAGCACAACATCATCTGCATTGAGGACCTT
GTGCACGAGATCTTGACCGTCGGCCCACACTTTAAGGAGGCGAACAACTTCCTGTGGCCATTCAAGCTCAAGGCTCCGCTCGGTGGCCTGAAGAAGAAGA
GGAACCACTACGTCGAGGGTGGTGACGCTGGGAACCGTGAGAACTACATCAACCAGCTTGTTAGAAGGATGAACTAGGTTGAATGAGCTACTTGATGATA
ATAGCCTGTGTTGGAAGGATAAACTTGTTTTCACATTAGGAAGTGGATGATGAGTATGCATGCGTTTTTTGTATTCAGAACTAGACATGTTTGGATGAAA
TCTCACATTTCCTCTAGAGGGTTCGATTCATTATTAATGCTTTTACTGTGGGTCGCAAACGTGCTTTTGTTTCTGTTATCAAGGATATACTATTTGTATT
ATGATAGTCGGTTACACATTCTGCCCGGCTGCCTTTGCCAT
page-top