Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4061  (registered. 2012)
Contig Information
Length 1082 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 6
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|162463849|ref|NP_001105634.1|| ribosomal protein s6 RPS6-2 [Zea mays]
Score 457
Evalue 1.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4061
TTTTTTTTTTTTGAGTAGAAACTAACATACAACTCTGGCAAACTCATGACAATAGAGTACTCATCATGTTCATGGTAAACTGCATCAGGTACAAGCCCAA
GAAAGCTACTCCAGTAACAAAACTTCTGACAATAAAGTACCCATGTTCACGCAAAACTGCATCAATTACCAACCCAAGAAAACTGAAAGTTGCGGGTAGA
TTTTTCCAACAAAGTGCGAAGGACTGTAACCATCTTAAGCAGAGGCAGCAGGAGCCTTGGTGGCAGCAGACAGCTTCGACCTCCTCTTGGCCATGCTCTC
GCTGCGGCGGTCTCTCTGCTCCTTGAGCCTCTGTGCAAGCAGCTTTTGGTACTCTGCAGCCTCTGACTTCTTCTTCGCGATCCTCTTCTTCTTGTCTGCA
ATTCTGGCACGCTTCCTCTGGAGGGTCAAGGGAGTCACGAGACGCTGGATCTTGGGAGCCTTGCTCACCTTCTTGCCCTTCTTGTTAAGGAAGGTCCTGC
GGTATGTGTTGACATAGCTGCGGACATCATCATCCTTGCCAAGGTTGAAGAGCTTCTTGATCTTGGAAGCCCTCTTGGGTCCCCTCATCCTGGGCTTCTC
AGTGTCGGTAAGGCCTGGCAGATCATTCTCACCCTTCTTGACAATCACCAAGTTGATAACAGACAGGTCTTGGCTGACAATGCAACCACGGACGGACTTC
CTCCTGCGCTCACCATTACGCCTGCCAAACCCACGGAAGCAAGGTGTGCCCCTGTGAAGCAGAAGGCGGACACGCCCAGAAGTTAGCACTCCTTGCTTCA
TTGGGAAACCCTGCTTATCGCAGCCACCCATGATCTTGAAGATATAACCCTTGAATTCCTCACCCAGAAGATCACCAACTACCTCCTGGGAGATTCTCTT
GTCATAAAGGTTCCGCAGCTTCTGGTCGTCATCGATCTCGACCTTCTTCTGGCACCCCGTGGTGGGGTTCGCGATGTTCAGCTTCATGGTGGAGTCGCGG
CACGAGCTCGCCGGCGGCGAGCAAACCGAACGCTGGGTGGAGCGGCGGCGGCGGCGGCGCGGTTGCTCGAGGGGTAGGGTTT
page-top