Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4042  (registered. 2012)
Contig Information
Length 948 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XA Root 5
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4165490|emb|CAA10664.1|| beta-tubulin 2 [Hordeum vulgare subsp. vulgare]
Score 471
Evalue 4.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4042
TAGGATTCAGAGCCATATTACAAACCTGCTACTAAGATCTCAAGTCCACCGTAAGGCGCAACAAACTGACTACCGAATTAACCCGACACAGACCAACTAC
ACAACCAGCAACAAGTCCACAACCCCCCGAAGATTGGGGCCAGCAAGCGCGAAACACACACTACTAGTAGCGACATGGAGCCATCAGAAATAGCCCCTGA
CCGAGCACGCACACGATCACGGAGGAACACAGACCTCGCTCGCTCGCCCCTACTCCTGGAGGTCGGCGTCGTCCTCGTCCTCGTACAGCTCCTCCTCCTC
GTCGGCGGTGGCGTCCTGGTACTGCTGGTACTCGGCGACCAGGTCGTTCATGTTGCTCTCGGCCTCGGTGAACTCCATCTCGTCCATGCCCTCGCCCGTG
TACCAGTGAAGGAAAGCCTTCCTCCTGAACATGGCCGTGAACTGCTCGCTCACCCGCCGGAACATCTCCTGGATGGACGTCGAGTTGCCGATGAAGGTGG
ACGCCATCGACAGGCCCCTGGGAGCGATGTCGCACACGCTCGACTTGACGTTGTTGGGGATCCACTCCACGAAGTAGGAAGAGTTCTTGTTCTGCACGTT
GATCATCTGCTCGTCAACCTCCTTGGTGCTCATCTTGCCGCGGAACATGGCCGAGGCCGTCAGGTAGCGGCCGTGCCGGGGGTCGGCGGCGCACATCATG
TTCTTGGAGTCCCACATCTGCTGGGTCAGCTCCGGGACCGTGAGGGAGCGGTACATCTGGGAGCCGCGGGAGGTCAGCGGCGCGAACCCGACCATGAAGA
AGTGGAGACGTGGGAAGGGGATCAGGTTCACTGCCAGCTTCCGGAGGTCGGAGTTCAGCTGGCCGGGGAACCTCAGGCAGCAGGTCACTCCGCTCATGGT
GGCAGAGATCAGATGGTTCAAATCTCCAAAGCTGGGAGTGGTCAGCTG
page-top