Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4035  (registered. 2012)
Contig Information
Length 708 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|13925734|gb|AAK49427.1|AF262983_1|AF262983_1 cyclophilin A-2 [Triticum aestivum]
Score 306
Evalue 4.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4035
CGGCGGCGCGCCGGCCGGGCGCATCGTGATGGAGCTGTNNNNNACGCGGTGCCGCGGACGGTGGAGAACTTCCGCGCGCTCTGCACCGGCGAGAAGGGCG
TCGGCAAGAGCGGCAAGCCACTGCACTACAAGGGCAGCTCGTTCCACCGCGTGATCCCCGACTTCATGTGCCAGGGCGGCGACTTCACCAAGGGCAACGG
CACCGGCGGCGAGTCCATCTACGGCGAGAAGTTCGCCGACGAGAAGTTCGTCCACAAGCACACCAAGCCCGGGATCCTCTCCATGGCCAACGCGGGCCCC
AACACCAACGGCTCCCAGTTCTTCATCTGCACCGTCCCCTGCAATTGGCTCGACGGCAAGCACGTGGTCTTCGGCGAGGTCGTCGAGGGCATGGACGTCG
TCAAGAACATCGAGAAGGTGGGCTCCCGCAGCGGCACCTGCTCCAAGCAAGTCGTCATCGCCGACTGCGGCCAGCTCTAGATCCGTCCGCCCGCCGGTCG
CCTGTCGTCGTCGCCCCGTGTCCCGTGTCGTCGATCTAAATAAGAGAGTCGTGTGTCGTGTCGTGTCTTCCCCTTGTCCGTCCGATGAGATCTCCGTGGT
TGGTTTANNAGGGTTTTAGGTGGACTCTTTTGGCCGCTGGATCTGTGTCCGGCGGCCATGGTTATCTTCCTGTGTCTGCTGCTATCTTACTGTTTGAATG
AGATGAAC
page-top