Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4032  (registered. 2012)
Contig Information
Length 816 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_SP 1
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502949|ref|NP_001149726.1|| 60S ribosomal protein L5-1 [Zea mays]
Score 357
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4032
AGCATGAAACAGCCGCAAAAACAACATTAGAAAAGGGTGCAAGACGAACGGATTAAGATTAAGATCCAAATGCCAGCACGGCACATAATCCAGATAACAC
AATCTATAACTCCAGCAGGACAAACAGAACTCAATGGAACAGGTCATTGTGCAGAGTGCCGGACTTCAACAAAAACGCACGTTGCAAGACTACACTGGGG
TGGACAAAGAGCTCTTCACTCGTCGTCATCCTCATCGTCATCGGCGGCACCCGCAGAGTTGTTGAGGGCGTTGAGCCTTTCGACGAGGCTGGCCTTCCTC
TGCTCATAGGTCAGCTTCTTGGGGTTGTATCTCTTGTGAGTCTTGGGAGGCGCCTTGGTTGATTTGGCCATGGTGGGATCAGCACGGATGGCAGCATGAA
CCTTCTTGTAAACTGCTTCCATGTCATCAGCTGAGATTCCCCTCTTGATGTACTCACTGAAGTGAGTTTGGAACTTCTCTGGTTCCTCATCTGCTAGTGA
CCTCATGTAGTCAGCAACATGCCCTCCAAAGATGTACTTGCGGTGAATCTCAGCATCCAGCGACTTCTCATCCTTTTTGAAACCAGCAAATCTCTTGTCA
CTGTGGGGAATGTCAAGACCACCGTCCAAAGCTCCCTTAAGGGCACCAAACACACGGTTTCCAGTGGTGGTCCTAATAAGACCAACATCCAAAAGCGCAC
GGAAAGGCCTCCTCTCATCAGAAGGCTCAACAGAGAAGTCCTCGCCAGTGGCCTCAACATTGCCTTCATACTCCTCATCAAGATCACGGTTCTTGAGCAC
ACGACGGGCCAAAAGC
page-top