Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4030  (registered. 2012)
Contig Information
Length 715 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 4
Wh_SHDr Shoot grown with dessication 3
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|38174807|emb|CAD42633.1|| putative immunophilin [Hordeum vulgare subsp. vulgare]
Score 290
Evalue 1.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4030
GCACGAGGGAACAAACCCCAGCTGCATCCATGGCGAAGCCGCGGCTTCTTCTCTTCCTGCTGGTCGCCGCCACCGCGCTCCTGCTCGTCGCCTCCGCCAA
GAAGTCCGGCGACGTCTCGGCGCTCCAGATCGGCGTCAAGTACAAGCCAGAATCGTGCAGCATCTCGGCTCACAAAGGTGACAGAGTTAAAGTTCACTAC
CGTGGAACACTTACCGATGGAACAGTTTTTGATTCTAGCTATGAAAGGGGTGACCCGATTGAATTTGAATTGGGCACTGGTCAAGTGATCAAAGGATGGG
ACCAGGGAATTTTGGGCATGTGCATTGGTGAGAAGAGGAAGCTGAAGATCCCTTCAAAGCTCGGCTATGGGGATCAGGGATCGCCACCTACCATTCCAGG
CGGAGCAACTCTCATATTCGACACAGAGCTTGTCGCTGTCAATGGCGAGCCATCTAGCAAATCAGACGAGGATGACGCTGATCTGTAGGCAGCTCGGCGC
AGCACGATCGCCCAGTTATCAAATCGAATAGGACTATGTATGGGAAACTTACTCTTGTAGGGCAGACACAATGAGACAGGAACATTGTCTTACCATGATC
AAACAGAGGAGTCTAGTTCTCAAAATCGAATAGATCAAGTGACTTTTGTTACCCTATGTAATTCTCTGGAATAATTCTTCTATCTACCTTGTTACTTTTG
CTTTTATTCTTGGAA
page-top