Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4023  (registered. 2012)
Contig Information
Length 950 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 6
Wh_OKCS Seed DPA5 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458498|ref|NP_001052849.1|| Os04g0435700 [Oryza sativa (japonica cultivar-group)]
Score 433
Evalue 1.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4023
TATCTTCAGTGGAGGGAGAGAAGATGGTGCTTGTTGCATGCGGATGGCGCCATACCATTACTGTTTCCTCCTCTGGTAGTTTGTACACTTACGGTTGGAG
CAAATATGGTCAGCTTGGGCATGGCGATTTTGAAGATCATCTAGTTCCACATAAAGTGGAAGCCTTGAAGGATAGCTCTACATCCCAGATTTCAGGTGGA
TGGAGGCATACAATGGCACTTACATCAGATGGAAAGCTTTATGGATGGGGATGGAACAAGTTTGGGCAAGTTGGAGCTGGCGATAATGCCGATCACTGTT
CCCCCGCACAGGTTAATTTTCCCGAGGAACAGAAAGTTGCCCAAGTTGCTTGTGGATGGAGGCACACTCTTGCTTTCACAGAAAAGAAAAATGTGTTTGC
ATGGGGAAGGGGTACTAGTGGACAACTCGGTCATGGGGAAATAGTTGACAGGAACACGCCTGTGATGATTGATGCCCTAAGCCCGGACGGTCCTGGCTGC
AAGAAGTTGGAGTCTTCAGCAGCTATTCCCTTTGCAGCTAAAATTTGGGTGTCACCCTCTGAAAGATATGCTCTTGTTCCTGATGAGAAGGTTGCCAAAC
CAGGCGATGTCAGCGCACGTGGCAATGGTGCGGATGCGAGTGTGCCCGAGAACGATGTAAAGAGGATGCGCGTGTCATCCTAGTTCGATGACATATCATC
TATGTACCTCATTAACCCTAGCACTACTATCAAAAACCCTTGCGCGTCGTTCACCAGTTTCCACCTAGTGGTGTCCAGTTCTTGTGCATTCCGTTCTGCC
GAAGTACTTTCCAGAAGAGGAACCTCCTTCTCCTGGCGTTGAGATGATGTATCAGCACCTATGGGCTGTGGTGTATAATTCACCTCTTAGAGGTGGCTAG
TAGAATCAACCTGGACCTGTGTTCTGAATGTTTCGGTAGCTGCATCCGAC
page-top