Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3018  (registered. 2002)
Contig Information
Length 594 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 1-aminocyclopropane-1-carboxylate oxidase [Phyllostachys pubescens]
Score 448
Evalue 5.97622e-43
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig3018
atgctggtcggaagcagcacaacacagcgaaaatgACAAACACTCCTACTTACTACAGATCCTAGCTAGGCGTAGCACACAAGCCAGCACAGGCTCGTTT
ATTCGGCACCAAACAGTAGCCAGTGGTCTAGCACGTACGTACGTACGAACTCTGGAGCATCCTATGTGCCATCGTCCTCAACCATTAACCGAGGCCAcgt
acggagagcagagcaagggttgcttctaagcggtggcgatgagcttggtgctctggctctccatggacttgaaggcctcgaacctgggctccttgtcctc
gaacttgtggcgcacgtacagcttcatgtagtcctcgaacacgaacctggggtacgccccgccggccgcctccgcctccgccagcgccggcgccgggaag
atcaccgcgtcgctggccgggttgtagaaggaggcgatggacatccggttgccgtcggcctgcgcgaccacgcggtggagcacgctcttgtaccggccgt
tggtgatcacctccagctggtcgcccaggttgacgacgatggagtggcgcgtgggcggcacgtccacccacttcgccgtccctgagcagctgga
page-top