Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2790  (registered. 2002)
Contig Information
Length 638 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit group 3 late embryogenesis abundant protein
Score 785
Evalue 5.90216e-82
Total Hit Count 61
Registered year 2002
Contig Sequence     [ Download ]
>Contig2790
agGACgcccgggcGAGCGCTCGCCGGCTCGGCCAAGGATAGCGAGGGCGAGACGAAGGAGTCGGCGTGGCAACAGGGCCAGGATGTGCGGCGGcgggcgG
CGGAGAAGGCCGAGGAGGCTCGTCAGCGCACGCACCAACCACCGGAGGAGGAGAGGTCGAAGTTGGCAACGGAGAACATCTTCGGGTCGGCGCAGGGGTT
GACGGAGGCGTTCAAGGAGAAGATGACGATGCCGACGGACGTGATCGAGCGGAAGCTCGCTGAGAGGAAGGGGACGACAAGGGACGCGGGCAGGGGCGAG
GCACTGAACGCGGACGACGTGATGATGCGCGTGAAGGAGGCGGACCAGATGACCGGGACAGGGTTTAACGACGTCGGCAAGATGGGCGAGGAGGGCACCG
GCATGAAGGCGGCACTGAGGGCCGACGACGAGGAGGACGTGATGCTGCGGGTGAAGGCGGCGGACCAGATGACAGGGCAGGCGTTCAACGACGTCGGCCC
GATGGGCGAGGAGGGCACGGGATGGGGTCCGGCATTGAGGGCgcggaaggacgcctgaagcatgcacacctgttgcgtgtgagcgttttgtgtgacactt
tgtacgagctactcctgtagcaaataataaattagagt
page-top