Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2787  (registered. 2002)
Contig Information
Length 909 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein NCU07493 [Neurospora crassa OR74A] >gi|28926841|gb|EAA35804.1| predicted protein [Neurospora crassa OR74A]
Score 84
Evalue 2.25232
Total Hit Count 33
Registered year 2002
Contig Sequence     [ Download ]
>Contig2787
ttcggcacgaggcttggagatggagcacgccgccgctgtcatcactctcttctacggcgtcatgcaatgcatggtcgccggcttcggcgccgcggtgacg
ggctcgaccgcacctccttccgtctccgcATGCActtccctTGCCGCGCACGGGGGTGTCCCAGGTTGCGACCATTGCCAGGACAGGCTACAGTCCGGCG
CCGCGCTCGCCGAGGAGCTGAGCGCAGGACCGCGTCGGCGCGTCGGACGACCTGAGCTCTCTGGATTCCAAGCAGTGGGAGAAGGCTTTTGTGGACTGCG
TCGTCGTCTAGGCATGCGCCAGCAATCTTGACCTCGAGCCCGGCCTACCAGCCGAGGCCACGAGCTAGCGACCTCTCAGGCTGAAGGCCCGCCAATCCTT
GTCACGTCTCCACCGGCTGGACGTTGCGTTCGCCCAGGTTGCCGTCGCCTTGCCATCCAGCGCCATCGGAGTCTTTCCCCCGTGTCGTCGTCATGAGACT
GGAGAGGTGCTACCTCGGCTATACTAGAGCCAAAGCGGACGTGACGACGCACTCCTGTTCCTTGCCCACCTCGATCGTCGTCAACTGCGGGATGGCGAGC
ACACGGGCGGTTGCCTCTTCCTCACCTCTATGTTGTGTGCCATGCGTGCTGCTTGCATGTTGCTGCTGTGTCAGTGCGTGCCGTGAGGTCTGCGTGGCcg
cgcactgctccaaccagtcgaccacacactggatgcccgccgcccactgtcgacctgcgagccacctgcgccgccgcgacgaactgcgtgagcacctcca
tggcatcgtgccaaatgagactgactagatgcagcatgctagaacatatagcatgttcctgtgatgtcatgccaaactgcagtttgtggaagggtggttt
agcctgcag
page-top