Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2786  (registered. 2002)
Contig Information
Length 1073 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to retinitis pigmentosa GTPase regulator-like protein, partial [Strongylocentrotus purpuratus] >gi|115932078|ref|XP_001189111.1| PREDICTED: similar to retinitis pigmentosa GTPase regulator-like protein, partial [Strongylocentrotus purpuratus]
Score 84
Evalue 2.93469
Total Hit Count 10
Registered year 2002
Contig Sequence     [ Download ]
>Contig2786
agaggtcgtcttctccgattccggcaactactgccgccgccactgttcggatggttccgacgccgtccggcccttcctctcacaagtttatccaccacta
gcctccttgagcacccattgatccacccccacactcaattttgcccgggagccaccataggcgaaacacccaattcgtctccgccggagctcctcgggtg
agctcgccgccggcgactccctccactccagcgacaaaggagggtacccacatgtccgcctcaaccttctgagctcgtaggaggcctcggttttccaaac
ggtgccgcctttcgccggcgccgaccgccggagctccgcctctgttcggccggagaaggaggcgcgcgcgtggactggtcaaacctgaccagtgggccgg
gcgggcCCACTGCCAGTGACTCAGCGCGGTGCCAGCTCATTTTAAGTGGAGACGTTTTCCCCAAAGTACGTCTCCTCCACCGGAAAACGTACAATAGTAA
AGACGCCTTCGACGTCGCAACCCTCCCACGCAGCCAAACGACTGGGCTCGGCCCAGTAGCGCTAGGCGGCTATACTGCGCCCAGGGCGCGTTTCTGCTCA
GCCCATCACAGAAATGGAGGGGAGATataatttccaagttttggagtgcgcctaatctttctgcatgctcaagatcatgattcagagaggagtactacga
agccacctcgcaacctaggattcagagatagcaaccgcgcgagataggagttatccaggtcagctgttcccgtgggaatggagttccatcagcgttggag
atccacgagtcgcttccattatttgccactcgaaatcattgttgtactcaatggacctataaggtcttgtactcaaatccttgtaatttcttggaattct
gtatcaaggaaatatccaccagcaacagtaatcctggggctggtggtgacataagggtcgtttgctgggaatttatgtcccggaaatccggccccgacaa
ccttggtatcagagctaggctgaccaccggctaatcctatcttagccggtcactatccctagggtttcacacc
page-top