Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2785  (registered. 2002)
Contig Information
Length 822 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0702G05.5 [Oryza sativa (indica cultivar-group)]
Score 191
Evalue 7.3816e-13
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig2785
agaggaaagagttggagaaacaaaaacgtctggaggaagagaggcaaaaacgtctggagggagagaggaaggagcttgagAAGCAAAAGCAGAGGGCGAA
GGAGGAAGAGACACTGAAAGAGAAGGAACATGAGCGGAGGAAaggtgagcATGGTGTGGAAAGGGACAGCAAAAGAAAGGTTGGAGAAGATAGGTACGAC
CCAAATTCAAACAGACTCAGCGATGATGAAAATagggaggaccgaaagACGCGTGAAGATTATGGTCGACAGAAAACTACAGATTCAGATAGGTATGACC
CAAATTCAAACAgacatAGTGATGATGAAAACAGGGACcggaagAGGCATGAAGAGTACGGTCGACACAGAGCTAGattttcAGATAGCCATGATTCAAA
GAGGTCTAGATATGATGACTCTTATAACCACTCGAGGAGGGATTATGAAGAGCGCTATTCTAGAGATGAGCACAGAGACAGGAGGCATCGTTgaatgCAG
AAGTTATCTTAAAATGCATCTCATTTCtatgaAGCGAAGTGCAGCGCTGGTACATCTTGTTGAGCAaggacagtaacattggcgccattgaagaaggctc
agtcgcctagcgcaagattttggccatatgtgtactgctagtcgtcatccagcaacgctgttttgccgctgcggggaagttttgtttgctcatgtttgta
tggactttctcctctctgttttgtcagtcttgagtatgtaatgtggaggttatattgttacaccggtggcatcatgttgcccagcaacaatgtgggagat
gtatctaacctatgcttttttg
page-top